Skin-associated lactic acid bacteria from North American bullfrogs as potential control agents of Batrachochytrium dendrobatidis
Authors:
M. V. Niederle aff001; J. Bosch aff002; C. E. Ale aff001; M. E. Nader-Macías aff004; C. Aristimuño Ficoseco aff004; L. F. Toledo aff005; A. Valenzuela-Sánchez aff006; C. Soto-Azat aff006; S. E. Pasteris aff001
Authors place of work:
Instituto Superior de Investigaciones Biológicas (INSIBIO), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) and Instituto de Biología “Dr. Francisco D. Barbieri”, Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tuc
aff001; Instituto Superior de Investigaciones Biológicas (INSIBIO), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) and Instituto de Biología “Dr. Francisco D. Barbieri”, Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tuc
aff001; Museo Nacional de Ciencias Naturales, CSIC, Madrid, Spain
aff002; Research Unit of Biodiversity (CSIC, UO, PA), Oviedo University—Campus Mieres, Spain
aff003; Centro de Referencia para Lactobacilos (CERELA), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), San Miguel de Tucumán, Argentina
aff004; Laboratório de História Natural de Anfíbios Brasileiros (LaHNAB), Departamento de Biologia Animal, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil
aff005; Centro de Investigación para la Sustentabilidad, Facultad de Ciencias de la Vida, Universidad Andres Bello, Santiago, Chile
aff006; Instituto de Ciencias Ambientales y Evolutivas, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile
aff007; Organización No Gubernamental (ONG) Ranita de Darwin, Santiago, Chile
aff008; Organización No Gubernamental (ONG) Ranita de Darwin, Valdivia, Chile
aff009
Published in the journal:
PLoS ONE 14(9)
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pone.0223020
Summary
The fungal pathogen Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis and has been a key driver in the catastrophic decline of amphibians globally. While many strategies have been proposed to mitigate Bd outbreaks, few have been successful. In recent years, the use of probiotic formulations that protect an amphibian host by killing or inhibiting Bd have shown promise as an effective chytridiomycosis control strategy. The North American bullfrog (Lithobates catesbeianus) is a common carrier of Bd and harbours a diverse skin microbiota that includes lactic acid bacteria (LAB), a microbial group containing species classified as safe and conferring host benefits. We investigated beneficial/probiotic properties: anti-Bd activity, and adhesion and colonisation characteristics (hydrophobicity, biofilm formation and exopolysaccharide-EPS production) in two confirmed LAB (cLAB-Enterococcus gallinarum CRL 1826, Lactococcus garvieae CRL 1828) and 60 presumptive LAB (pLAB) [together named as LABs] isolated from bullfrog skin.We challenged LABs against eight genetically diverse Bd isolates and found that 32% of the LABs inhibited at least one Bd isolate with varying rates of inhibition. Thus, we established a score of sensitivity from highest (BdGPL AVS7) to lowest (BdGPL C2A) for the studied Bd isolates. We further reveal key factors underlying host adhesion and colonisation of LABs. Specifically, 90.3% of LABs exhibited hydrophilic properties that may promote adhesion to the cutaneous mucus, with the remaining isolates (9.7%) being hydrophobic in nature with a surface polarity compatible with colonisation of acidic, basic or both substrate types. We also found that 59.7% of LABs showed EPS synthesis and 66.1% produced biofilm at different levels: 21% weak, 29% moderate, and 16.1% strong. Together all these properties enhance colonisation of the host surface (mucus or epithelial cells) and may confer protective benefits against Bd through competitive exclusion. Correspondence analysis indicated that biofilm synthesis was LABs specific with high aggregating bacteria correlating with strong biofilm producers, and EPS producers being correlated to negative biofilm producing LABs. We performed Random Amplified Polymorphic DNA (RAPD)-PCR analysis and demonstrated a higher degree of genetic diversity among rod-shaped pLAB than cocci. Based on the LAB genetic analysis and specific probiotic selection criteria that involve beneficial properties, we sequenced 16 pLAB which were identified as Pediococcus pentosaceus, Enterococcus thailandicus, Lactobacillus pentosus/L. plantarum, L. brevis, and L. curvatus. Compatibility assays performed with cLAB and the 16 species described above indicate that all tested LAB can be included in a mixed probiotic formula. Based on our analyses, we suggest that E. gallinarum CRL 1826, L. garvieae CRL 1828, and P. pentosaceus 15 and 18B represent optimal probiotic candidates for Bd control and mitigation.
Keywords:
Fungal pathogens – Bacterial biofilms – Amphibians – Lactobacillus – Exopolysaccharides – Enterococcus – probiotics – Lactic acid bacteria
Introduction
Amphibians play an important ecological role in the transport of energy from aquatic environments to terrestrial ecosystems, and several factors have been proposed to contribute to their population declines worldwide [1,2]. Among the threats to amphibian survival, the most commonly cited are habitat loss, pollution, the pet trade, climate change, and emerging infectious diseases (EID) [3]. Chytridiomycosis is a major amphibian EID caused by two congeneric species of chytrid fungi: Batrachochytrium salamandrivorans [4] and B. dendrobatidis (Bd) [5–8]. In anurans, Bd proliferates in the keratinized epithelial cells of post-metamorphic animals and the mouthparts of tadpoles [9] with mortality occurring due to osmotic imbalance and subsequent asystolic cardiac arrest [10]. In addition, Bd has been shown to inhibit normal lymphocyte function and proliferation and disturb cellular energy pathways [11,12].
To date, Bd control in nature has proven difficult [13] since amphibian populations can host multiple Bd genotypes, such as BdGPL (Global Panzootic Lineage), BdHybrid lineages, as well as endemic lineages [14,15]. There is only one effective practical intervention eradicating Bd based on antifungals [16], thus probiotics represent an attractive alternative tool for Bd control in nature [17–19] with potential advantages over antifungal drugs, which are difficult to apply in the wild and may have profound effects to the native microbiota of a host or ecosystem [16,20]. In aquaculture, probiotics may confer benefits to the health of their host or the environment through different modes of action including antagonistic activity against pathogens [15,20–28], enhanced competitive exclusion of pathogens through increased host microbial load and diversity [15,17,29], modulation of pathogen virulence, adhesion to host epithelial cells, stimulation of the immune response [17,30–32] and improvement of water quality [33].
In amphibians, the first line of defence against pathogens is the skin, where two key protective mechanisms may operate: the microbiota associated with the cutaneous structures (epithelial cells and mucus) [34], and the antimicrobial peptides produced by glandular glands and secreted within the host’s skin [35]. Bacterial species of the amphibian skin microbiome can provide protection from Bd infection through competition for nutrients and chemotactic factors [36,37], as well as through the production of antifungal metabolites [21]. Several in vitro studies have reported anti-Bd activity of skin-associated Gram-negative and some Gram-positive bacteria isolated from different amphibian species (Table 1). Based on the ability of bacteria to produce antifungal metabolites (such as violacein, prodigiosin, 2,4-diacetylphloroglucinol, indole-3-carboxaldehyde) some bacterial strains [20–28] or species combinations (e.g. production of tryptophol in Bacillus sp. and Chitinophaga arvensicola mixed communities) [38] have been selected as potential probiotics to mitigate Bd infection and chytridiomycosis development.
The normal microbiota of North American bullfrog (Lithobates catesbeianus; from here on referred as “bullfrog”) skin in hatchery conditions is known to include Enterobacteriaceae (Citrobacter freundii, Enterobacter spp., Escherichia coli, E. blattae, Klebsiella spp., Proteus vulgaris), Pseudomonas aeruginosa, Staphylococcus epidermidis, Bacillus spp., Micrococcus spp. and Lactic Acid Bacteria (LAB) [39–43]. This last group is specifically classified as Gram-positive, catalase and oxidase negative, indol and nitrate negative, non-sporulating and usually non-motile microorganisms. According to studies performed in different niches, LAB comprise the following genera: Carnobacterium, Dolosigranulum, Lactobacillus (rods); Aerococcus, Alloiococcus, Enterococcus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus (cocci), and Weissella (coccoid or rod-shaped) [44–47].
On the basis of their Generally Regarded as Safe (GRAS) properties (no translocation ability, absence of virulence factors, no antibiotic resistance) [48], Food Grade characteristics and Qualified Presumption as Safety (QPS) for the European Food Safety Authority (EFSA) [49], some LAB species have been proposed as probiotics in aquaculture for infectious diseases control and improvement of zootechnic parameters (animal growth and nutrition) [50–52]. These microorganisms produce a range of antimicrobial metabolites such as organic acids, bacteriocins, diacetyl, and hydrogen peroxide. Bacteriocins are known to inhibit other LAB strains, some Gram-negative pathogens and Gram-positive spoilage bacteria [53,54], as well as moulds and yeasts [55,56].
A broad range of microbial characteristics such antimicrobial activity and adhesion/colonisation properties must be considered when selecting microorganisms to be included in a probiotic formula [48]. In particular, key properties include the hydrophobicity of the bacterial cell surface that can impact bacterial adhesion to skin epithelial cells [57], while auto-aggregation (an interaction phenomenon that occur between microorganisms of the same strain) [58], exopolysaccharide production and biofilm formation [52,59,60] can impede pathogen colonisation of the host skin [61].
Ranaculture is a branch of aquaculture that involves raising amphibians for commercial purposes. The bullfrog is the most globally reared amphibian species and is grown to provide meat while by-products such as the skin are used as a source of compounds in human antitumor therapy [62]. However, bullfrogs are vulnerable to bacterial infection diseases in hatcheries conditions and are also well known for its Bd carrier capability [63–66]. Since LAB are commonly found in the native microbiota of bullfrog hatcheries and some strains have previously been selected as probiotic candidates for control of Red-Leg Syndrome (RLS) [39–43], we evaluated their potential as probiotics by measuring the inhibitory activity of confirmed LAB (cLAB) and presumptive LAB (pLAB) from bullfrog skin on Bd isolates from multiple lineages, in addition to properties related to host adhesion and colonisation. Taking into account that microorganisms intended for inclusion in a probiotic product must be correctly identified [67], we carried out genotypic characterization of selected isolates as well as compatibility assays for the potential formulation of mixed probiotic consortia.
This study contributes to our understanding of probiotic design and demonstrates a potential future use of GRAS microorganisms for Bd control in situ and during the ex situ breeding of endangered amphibian species.
Material and methods
Microorganisms and culture conditions
For the all assays, unless otherwise stated, we used Enterococcus gallinarum CRL 1826, Lactococcus garvieae CRL 1828 (confirmed LAB-cLAB) and 60 presumptive LAB (pLAB) [together named as LABs, n = 62]. All bacteria were previously isolated from ventral and dorsal skin areas of captive bullfrogs in the fattening phase of growth in a hatchery located in central Argentina (Río Cuarto, Córdoba) [43]. All pLAB were classified based on staining (Gram-positive) and key biochemical properties (catalase negative, nitrate and indol negative) [43]. All LABs were grown in de Man, Rogosa and Sharpe broth (MRS in g/L: peptone, 10; meat extract, 10; yeast extract, 5; glucose, 20; sodium acetate, 5; triammonium citrate, 2; K2HPO3, 2; MgSO4.7H2O, 0,2; MnSO4.4H2O, 0,05; polyoxyethylene sorbitan mono-oleate-Tween 80, 1 mL) [68], pH 6.8 at 37°C for 12 h and then adapted by subsequent culture (72 h) in TG (16 g/L tryptone + 1 g/L glucose) broth, pH 7.0. In both culture media, the microorganisms were incubated in microaerophilia (5% CO2 atmosphere). For anti-Bd assays, we used eight Bd isolates belonging to hypervirulent, hypovirulent and hybrid lineages (Table 2). The isolates were cryopreserved in liquid nitrogen and recovered after two passages on tryptone-glucose-agar (0.9% w/v) (TGA) at 20°C for 7 to 10 days.
Anti-Batrachochytrium dendrobatidis (Bd) activity of confirmed and presumptive lactic acid bacteria (LABs)
We evaluated the anti-Bd activity of LABs using co-culture assays. Thus, after 4 days of Bd growth (maximum zoospore production), Bd plates were flooded with 3 mL of tryptone broth. After 20 min, the plates were flooded again and left to sit for another 20 min. The resulting liquid was then filtered through sterilized nylon (20 μm) and zoospore density was determined using a haemocytometer [23]. We then inoculated 500 μL of 2.7x106 Bd zoospores/mL on TGA and spread with a Drigalsky's spatula to produce a “lawn”. The plates were allowed to dry in a laminar flow hood until they were slightly moist and 10 μL of 1x105 CFU/mL LABs were streaked across the plates in a straight line and incubated for 7 to 10 days at 20°C. The score for antimicrobial activity was adapted from Park et al. [26] as follows: (A) no antifungal activity: the whole plate was evenly covered with Bd growth; (B) low antifungal activity: a minimal zone of zoospore inhibition; (C) medium antifungal activity: an asymmetrical inhibition area was observed around the bacterial zone of growth; (D) high antifungal activity: the Bd growth was only observed on the limits of the Petri plates; and (E) strong antifungal activity: no Bd growth was detected. A correlation analysis of anti-Bd activity of LABs was performed by using JMP Pro 12.1 software version (SAS Institute Inc.).
Hydrophobicity of the bacterial surface
We determined the hydrophobicity and Lewis acid/base properties of LABs by the Microbial Adhesion to Hydrocarbon (MATH) assay [73] using different organic solvents: xylene (apolar), chloroform (electron acceptor) and ethyl acetate (electron donor). The LABs were grown in MRS broth as indicated above, collected by centrifugation (3,000 g, 4°C) at the early logarithmic growth phase (7 h), washed twice and resuspended by using sterile distilled water to an Optical Density (OD600 nm) of 0.6. Chloroform, ethyl acetate and xylene (0.45 mL) were added to test tubes containing washed cells (2.7 mL). The samples were gently shaken in a vortex for 90 s. The tubes were left to stand for 15 min for separation of the both organic and aqueous phases. Then, the aqueous phase was separated with a 1000 μL micropipette and the OD was determined using a Shimadzu spectrophotometer (Shimadzu Corporation, Japan). The hydrophobicity was calculated using the following formula: % Hydrophobicity = [(OD before mixing-OD after mixing)/OD before mixing] x 100. The degree of bacterial hydrophobicity was classified as low (0–29%), medium (30–59%) or high (60–100%).
Exopolysaccharide (EPS) production and biofilm formation
We studied the EPS synthesis by LABs using the Congo red agar method [74]. The culture medium contained (in g/L): brain heart infusion, 37; sucrose, 50; agar, 10; and Congo red, 0.8. The stain was prepared as a concentrated aqueous solution and autoclaved separately (121°C, 15 min), while sucrose was sterilized using 0.2 μm Millipore membranes. Both stain and sucrose were added when the agar medium achieved 45°C. Plates were inoculated with 10 μL of 1x105 CFU/mL of each LABs and incubated for 48 h at 37°C in microaerophilic conditions. The presence of a dark blue microbial growth indicated that the isolate was an EPS producer. Lactobacillus casei CRL 87 was used as positive control [75].
The biofilm formation was assayed in each LABs using the crystal violet-stained microplate assay [76]. In brief, bacterial cells from the third subculture in MRS medium without Tween 80 were washed and resuspended in PBS solution pH 6.8 to get an OD540 nm of 1.2 (~ 4x108 CFU/mL). We then took a 100 μL bacterial suspensions and inoculated it into 2.5 mL MRS broth without Tween 80, an inhibitory surfactant of biofilm formation [76], and 200 μL aliquots were added to 96-well polystyrene microplates that were incubated under static conditions at 37°C for 72 h. Wells were washed three times using PBS solution at pH 6.8 and the quantification of the biofilm formed was carried out according to Leccese Terraf et al. [59,76]. Briefly, 200 μL crystal violet (0.1%) were added to the wells that were washed as indicated above after 15 min of co-incubation. The biofilm was detached using 200 μL absolute ethanol and quantified by measuring the OD540 nm. Additionally, sterile culture medium was included as negative control. For biofilm quantification, a cut-off (ODc) was defined as the mean OD value of the negative control. Based on the OD values obtained, LABs were classified as: negative (OD≤ODc), weak (ODc<OD≤ 2 x ODc), moderate (2 x ODc<OD≤ 4 x ODc) or strong (4 x ODc<OD) biofilm producers [77].
To interpret adhesion and colonisation properties of LABs, we carried out a multivariate correspondence analysis to evaluate the association between biofilm formation with EPS synthesis and auto-aggregation ability by using the InfoStat (2015p version) statistical software. For auto-aggregation, we used the data previously obtained in our research group [43]. All the assays mentioned above were performed in three independent trials and the average of the data were calculated and represented.
Principal Component Analysis (PCA) of probiotic beneficial/probiotic properties of confirmed and presumptive lactic acid bacteria (LABs)
We carried out a PCA using JMP Pro software version 12.1 (SAS Institute Inc.) to determine and visualize the beneficial/probiotic properties of studied LABs including auto-aggregation ability [43], hydrophobicity, EPS synthesis and biofilm formation.
DNA extraction and Random Amplified Polymorphic DNA (RAPD)-PCR analysis
For DNA extraction, LABs were grown in MRS broth as indicated above. Cells were recovered during the exponential growth phase (9 h) by centrifugation (3.000 x g, for 5 min at 4°C). Pellets were washed twice with sterile distilled water (SDW), fractioned in Eppendorf tubes containing 15 μL (SDW) and stored at -20°C. Then, cells were thawed, resuspended in 50 μL MilliQ water and microwaved at 700 W for 5 min [78].
The RAPD-PCR analysis is a simple and reliable method to assess DNA polymorphism. The ability to detect highly variable regions of DNA has application at the first stages of the bacterial species identification [79]. In this work, the M13 primer (5´GAGGGT GGCGGTTCT) [80] was used and the PCRs were performed in a TECHNE TC-512 thermocycler (Bibby Scientific, UK) under the following conditions: 5 min at 94°C of initial denaturation, 40 cycles consisting of 1 min at 94°C, 20 s at 45°C and 2 min at 72°C and a final extension at 72°C for 10 min. The RAPD reactions were carried out in a volume of 12.5 μL containing 3 mM MgCl2, buffer reaction (1x), dNTPs (200 μM each), 1 μM M13 primer, DNA (10–15 ng), and Taq DNA polymerase (0.1 IU; INBIO-Highway, Argentina). The RAPD products underwent electrophoresis at 100 V on a 2.5% agarose gel, stained with Gel Stain (Trans®, Beijing, China) and photographed under UV illumination. The RAPD-PCR patterns were grouped by means of cluster analysis with the Pearson product moment correlation coefficient and the unweighted pair group method using arithmetic averages (UPGMA). The RAPD band patterns (DNA fingerprint gel images) obtained were analysed using GelJ v.2.0 software [81] to obtain a dendrogram for both cocci and rods. Patterns with similarity values over 98% were considered genetically similar.
Genotypic identification of selected beneficial microorganisms
From the RAPD-PCR analysis, we selected 16 pLAB for 16S rDNA sequence analysis by applying two criteria: 1) isolates with antifungal activity against at least two Bd isolates of different lineages and the Expression of one Adhesion/Colonisation-EAC property (hydrophobicity, auto-aggregation, EPS or biofilm production); 2) isolates without anti-Bd activity and the expression of at least two EAC properties. To identify and classify the selected pLAB as LAB, we amplified and sequenced the variable regions of the 16S rDNA gene. The isolates were grown as indicated above and DNA was extracted according to Pospiech and Neumann [82]. The reaction was performed with PCR buffer (1x) (Invitrogen, California, USA), 2.5 mM MgCl2 (Invitrogen, California, USA), 0.2 mM dNTPs (Invitrogen, California, USA), 1 μM MLB16 (5´GGCTGCTGGCACGTAGTTAG) and PLB16 (5´AGAGTTTGATCCTGGCTCAG) primers (used to amplify an ~500 bp region of the 16S rDNA gene, which contained the V1 and V2 variable regions) [83], Taq DNA polymerase (2.5 U) (Invitrogen, California, USA) and MilliQ water, to get a final volume of 50 μL. DNA amplifications were performed in a Bio-Rad MyCycler™ under the following conditions: 4 min at 94°C of initial denaturation, 30 cycles consisting of 30 s at 94°C, 45 s at 52°C and 45 s at 72°C and a final extension at 72°C for 7 min. The PCR products were electrophoresed in 1% agarose gels, purified and sequenced using the DNA sequencing service of CERELA (Tucumán, Argentina). Identification was performed by comparing the obtained 16S rDNA sequences with those deposited in Genbank database using the BLAST algorithm and considering a percentage of identity ≥98% (e-value over 98% is = 0 in a fragment of 500 bp) as traditional species level cut-off.
Compatibility assays
To determine if the selected microorganisms could be included in a mixed probiotic product, we carried out compatibility assays among 18 LAB: E. gallinarum CRL 1826, L. garvieae CRL 1828 and the 16 LAB identified from 16S rDNA sequences analysis using the agar-well diffusion method [40,41,43]. All LAB were grown in TG broth for 9 h and the crude supernatants were used to determine its inhibitory effect. Compatibility assays consisted of 1x106 CFU/mL of one LAB (potentially indicator isolate) in five Petri plates containing soft TGA (0.7% w/v) that were punched to create 6 holes (10 mm each). Then, 100 μL of crude supernatants from each of the other 17 LAB (antagonistic metabolite producer isolates) were added to each well. Moreover, TG broth was used as a negative control. The presence of an inhibitory halo of the bacterial growth indicated that the isolates were not suitable for combining in a mixed probiotic consortia.
Results
Anti-Batrachochytrium dendrobatidis (Bd) activity of confirmed and presumptive lactic acid bacteria (LABs)
The anti-Bd activity of studied LABs against eight Bd isolates is presented in Table 3. Most LABs did not show any anti-Bd activity; however several LABs inhibited all Bd isolates with a score between low to medium. Likewise, three BdGPL and two hybrid isolates were highly inhibited by 10 LABs (Fig 1D and Table 3), while only two BdGPL isolates were strongly inhibited by five LABs (Fig 1E and Table 3). On this basis, we established an inhibitory score of sensitivity from highest to lowest inhibition for the studied Bd isolates: AVS7>CLFT159>CLFT024.02>CLFT001>AVS4>VA02>UM142>C2A.
We observed that approximately 67.8% of bacterial isolates did not inhibit Bd growth (e.g., pLAB: 3 against Bd: UM142), 16.3% showed low inhibition (e.g., pLAB: 35B against Bd: CLFT 001), 11.3% medium inhibition (e.g., pLAB: 16B against Bd: VA02), 3.6% high inhibition (e.g., Enterococcus gallinarum CRL 1826 against Bd: AVS7) and 1% strong anti-Bd activity (e.g., pLAB: 45B against Bd: AVS7) (Fig 1). A summary of the antimicrobial activity of LABs against Bd isolates of different lineages is shown in Fig 2.
Enterococcus gallinarum CRL 1826 was the most promising potential probiotic LAB since it inhibited the growth of all Bd isolates, with an efficacy ranging from low to high (Fig 2A). On the basis of the anti-Bd activity we also selected some tested pLAB as probiotic candidates. They include cocci 38B (medium inhibition against two hybrids, and from high to strong inhibition for two BdGPL isolates), 17B (medium to high inhibition against both two hybrids and three BdGPL isolates), 35B (medium inhibition against one hybrid and one BdGPL isolate) and 45A (from high to strong inhibition against one hybrid, and two BdGPL isolates, respectively) (Fig 2A). Among the rods, we selected the pLAB 1A (high inhibition against one hybrid), 17A and 45B (medium inhibition against one hybrid and from high to strong inhibition against two BdGPL isolates) (Fig 2B). Likewise, a partial correlation analysis used to evaluate the response of the Bd isolates when challenged with LABs revealed the pairs of Bd isolates that showed the highest similarity (i.e. higher positive associations) were VA02/C2A (0.5003), CLFT001/CLFT159 (0.4596) and AVS7/C2A (0.3604) (Table 4).
Hydrophobicity of the bacterial surface
Most of the LABs (90.3%) presented hydrophilic properties. For the hydrophobic isolates (9.7%), the mean values of adhesion to xylene, ethyl acetate and chloroform were 16.5%, 14.7% and 12.6% respectively. Some bacterial isolates showed both basic and acidic behaviour, such as E. gallinarum CRL 1826 and the pLAB 1B, 4C, 31, 39, 40A, and 40B, which exhibited a medium degree of hydrophobicity with xylene (nonpolar and acidic solvent; basic behaviour of the bacterial surface) as well as the pLAB 3, 10A, 10B, 17B, 22, and 40A with chloroform (monopolar and acidic solvent, basic bacterial surface properties). Likewise, pLAB 3, 22, 29, 38B, 40A, 43 and 42C demonstrated medium hydrophobicity using ethyl acetate (monopolar solvent; acidic bacterial surface character). From this group, we highlight isolate 40A, that adhered to all the solvents at the same level (37–43%) and this behaviour was likely due to the hydrophobic characteristics of its cell surface as observed for isolates 3 and 22, that adhered to chloroform and ethyl acetate (from 30.1 to 36.3%) (Fig 2).
Exopolysaccharide (EPS) production and biofilm formation
Our results show that 59.7% of LABs (n = 37) were EPS producers (e.g. L. garvieae CRL 1828, E. gallinarum CRL 1826 and the isolate 18B) (Fig 3). A total of 66.1% (n = 41) of LABs produced biofilm at different levels: 21% (n = 13) weak, 29% (n = 18) moderate, and 16.1% (n = 10) strong (Fig 2).
Correspondence analysis investigating the interaction between biofilm formation, EPS and auto-aggregation, showed that negative and moderate biofilm producing LABs were associated with non-EPS producers and low auto-aggregating microorganisms. Likewise, strong biofilm formation was associated with high auto-aggregating LABs, while those with weak biofilm production were related to LABs with medium auto-aggregating capability (Fig 4).
Principal Component Analysis (PCA) of probiotic beneficial/probiotic properties by confirmed and presumptive lactic acid bacteria (LABs)
The first two components provided by the PCA explained 89.2% of the variation between the samples (79% Component 1 and 10.2% Component 2) (Fig 5). The biplot shows the results of the first two components (F1 and F2). Biofilm, EPS and hydrophobicity with xylene had high positive influence on component 1, while hydrophobicity with ethyl acetate and chloroform had a positive influence on component 2. Although the pLAB 40A and 22 (anti-Bd activity against BdHybrid and BdGPL linages) displayed hydrophobicity, the last pLAB also showed auto-aggregation. Overall, E. gallinarum CRL 1826 exhibited the best profile of beneficial properties including the widest range of anti-Bd activity (Fig 2).
Random Amplified Polymorphic DNA (RAPD)-PCR analysis and 16S rDNA gene sequencing
By considering a similarity pattern over 98% for LABs (n = 62), the genetic diversity among the cocci was 51% (21 different genotypes from 41 isolates) while for the rods was 90% (19 different genotypes from 21 isolates). Cluster analysis of RAPD-PCR patterns of LABs (41 cocci and 21 rods) revealed similarity values ranging from 54 to 100%. The cocci could be separated into two distinct main groups with similarity coefficient (SC) between 54–65%. The first main group (SC = 54%) included one subgroup with six genetically close isolates (SC = 97%), while the second main group (SC = 65%) included two subgroups, one comprising 22 isolates and a SC of 74%, and another group with 13 isolates and a SC of 81% (Fig 2A). The cluster analysis also demonstrated the presence of two principal groups of rod-shaped LABs with a SC of 55%. The first main group included two subgroups (SC = 81%) and three isolates each, while the second main group (SC = 74%) contained two subgroups with three and 12 isolates, respectively (Fig 2B). On the basis of RAPD-PCR results as well as established selection criteria, 16 pLAB (11 cocci and five rod-shaped) were selected for bacterial species identification by 16S rDNA gene sequencing analysis. The isolates were subsequently identified as Pediococcus pentosaceus, Enterococcus thailandicus, Lactobacillus pentosus/L. plantarum, L. brevis, and L. curvatus (Table 5). Pediococcus pentosaceus 15 and 16B were isolated from the same animal and showed similar beneficial properties. Likewise, P. pentosaceus 17B, 18B, 30A, 35B, 38B, 22 and 45A were isolated from different animals and expressed different probiotic characteristics. Enterococcus thailandicus 1B and 31, L. pentosus/L. plantarum 1A and 41A, L. brevis 40A and 41B were isolated from different animals and showed similar beneficial properties. Only one isolated was identified as L. curvatus 42C and showed surface properties and anti-Bd activity.
Compatibility assays among selected lactic acid bacteria
Since LAB showed broad-spectrum inhibition across a range of Bd isolates, there is potential to design a multi-strain probiotic that may be effective in mitigating chytridiomycosis outbreaks. To this end, we performed compatibility assays among the 18 LAB that included E. gallinarum CRL 1826, L. garvieae CRL 1828 and the 16 identified LAB listed in Table 5. From our compatibility results, we did not observe any inhibitory halos (data not shown), indicating that all LAB can be combined in the design of a mixed probiotic formula.
Discussion
Considering that Gram-negatives have been proposed as probiotics owing to their high Bd inhibitory activity against BdGPL isolates [21,84,85], that LAB belong to the native microbiota of bullfrogs [39–41,43] and known safety of certain species [48], we evaluated the following physiological parameters of LAB to assess their suitability as probiotics: 1) the in vitro anti-Bd activity of LABs isolated from bullfrog skin against several Bd isolates from diverse genotypes, some of them related to amphibian declines [15], and 2) properties related to host cell adhesion and colonisation. We demonstrate that antifungal activity of tested LABs varied based on Bd isolate, even among closely related Bd genotypes such as AVS4 and AVS7 [71]. The C2A (BdGPL) was the least sensitive isolate in terms of LAB inhibition. Likewise, E. gallinarum CRL 1826 demonstrated promise as a probiotic candidate for Bd control since it showed medium to high anti-Bd activity against all BdGPL isolates. However, the CRL 1826 strain showed low inhibition of Bd hybrids. Conversely, pLAB 17B and 35B inhibited Bd hybrids to a medium degree. These findings support those of Antwis and Harrison [86] who showed that inhibition of different BdGPL isolates by a single bacterial strain is unusual. The diverse Bd inhibitory patterns exhibited by LABs may be explained by the fact that both kind of microorganisms were isolated from different amphibian species and geographical regions. Muletz-Wolz et al. [27] found that in Bd-negative salamander species, a small number of anti-Bd bacterial strains were present on multiple host species at various localities, but none were shared among all species and localities, indicating the strong influence of the environment over the structure of bacterial skin communities. It was also found that bullfrogs can harbour one of the less sensitive BdHybrids: UM142 [66], but also LABs [39–41,43]. Therefore, we can hypothesize that some LAB and the UM142 isolate could have coevolved by developing resistance to some antimicrobial compounds produced by the prokaryote group.
The in vitro anti-Bd activity of LABs observed in this study could be attributed to antagonistic metabolites (hydrogen peroxide, organic acids, aroma compounds, and/or bacteriocins) that diffused from the bacterial growth streak. Hydrogen peroxide generates oxidative stress and affects cellular signalling pathways [87], while the organic (lactic and acetic) acids exert their antimicrobial action after penetrating cell membranes in their undissociated form, leading to a drop in the intercellular pH and to the disruption of metabolic activities [88]. It has been reported that hydrogen peroxide alone or combined with both, acetic and peracetic acids, inhibits Bd growth [89], while bacteriocins and volatile organic compounds may be responsible for Bd inhibition [90]. We hypothesize that some of the metabolic end-products (alone or combined) synthesized by LABs, and probably some of those cited in Table 1 but not studied in LAB, would be responsible of the anti-Bd activity, and the mechanism of inhibition would depend on both LABs and each particular Bd isolate/lineage. However, competitive exclusion during the in vivo assays should not be discarded, especially when the potentially probiotic microorganisms have properties related to adhesion and colonisation processes.
The microbial surface plays an important role in how microbes interact with other microorganisms and the environment, mainly through adhesion to bacteria, eukaryotic cells [91] and other surfaces that allow colonisation of different ecosystems/hosts [92,93]. The mechanisms of bacterial adhesion include electrostatic and hydrophobic interactions (low affinity mechanisms) for which the acidic or basic characteristics (polarity) of the cell surface have a relevant role and can be used as criteria to predict adhesion capability [73,94]. Since hydrophobicity of the bacterial surface may be related to bacterial growth on hydrophobic substrates, auto-aggregation, biofilm formation and adhesion to host cells [57,95], this surface property must be considered as a relevant criterion for probiotics selection. The high proportion of hydrophilic microorganisms found in our experiments could be related to both the aqueous environment and the chemical nature of the mucus [96], and support the reported results for LAB isolated from another bullfrog hatchery in Argentina [39,41]. Hydrophilic LABs appear to be suitable probiotic candidates since they adhere better to the host mucus than epithelium, and would eliminate Bd by competitive exclusion and/or anti-Bd activity together with other components of the mucosome [14]. Considering that Bd is a keratinophilic pathogen [97] and thus must go through the mucus barrier to reach the outer epidermal layers, hydrophobic LABs may be relevant because they can adhere to the skin epithelial cells and inhibit fungal infections by specific blockage of cell receptors or inhibiting host attachment by steric interactions. Our hydrophobic LABs showed different patterns of surface polarity (acidic or basic). In Lactobacillus strains it has been shown that following an initial nonspecific contact with host epithelial cells, specific interactions occur between specialized molecules (adhesins) and epithelial cell receptors, in addition to S-coat proteins [98]. Therefore, based on our findings we propose that E. gallinarum CRL 1826 and pLAB 17B (medium hydrophobicity, auto-aggregating, anti-Bd activity), L. garvieae CRL 1828 (hydrophilic, auto-aggregating, without anti-Bd activity), the pLAB: 22, 29, 35B, 38B, 40A, and 40B (medium hydrophobicity, with anti-Bd activity), 43 (medium hydrophobicity, without anti-Bd activity), and 1A, 15, 18B, 30A, 41A and 45A (hydrophilic, with anti-Bd activity) may be potential probiotic candidates.
Bacterial surface polysaccharides are considered key macromolecules in determining microbe-host interactions through passive forces, electrostatic interactions, and hydrophobic and steric forces [99,100]. Surface polysaccharide production is widely reported in LAB isolates, in particular among members of the Lactobacillus genus [101,102]. Since polysaccharides display a high diversity among LAB [103], they are thought to be involved in determining relevant strain-specific properties for probiotic action, such as the degree of bacterial adhesion to host cells [104–106,60]. We evaluated EPS synthesis by LABs to inform the selection of potentially probiotic isolates with the goal of obtaining a high proportion of EPS producers. This beneficial property and those cited above, support the selection of E. gallinarum CRL 1826 and the pLAB 1A, 15, 18B, 40B, and 41A as potential probiotic candidates. Recently, Ringø et al. [52] established that live LAB from fish aquaculture can produce bioactive compounds such as EPS that maintain the natural state of microbe-associated molecular patterns (MAMP) structures contributing to the superiority of immunostimulant effects over the inactivated form of LAB.
Biofilm formation by LAB promotes mucosal colonisation and can mask epithelial cell receptors by preventing pathogen adhesion by competitive exclusion [107,108]. Our results indicate that approximately 45% of tested LABs were moderate/strong biofilm producers. This ability, together with the anti-Bd activity and surface properties, suggest the following bacterial isolates in the selection of probiotic candidates: E. gallinarum CRL 1826, L. garvieae CRL 1828 and the pLAB 15, 18B and 43. Although bacterial aggregation and EPS synthesis have a role on biofilm formation [109,110], our correspondence analysis indicated that biofilm synthesis was LABs specific with high aggregating bacteria correlating with strong biofilm producers, and EPS producers being correlated to negative biofilm producing LABs. With respect to aquaculture, Lamari et al. [111] reported biofilm production on abiotic surfaces in potentially probiotic Lactobacillus casei strains from Artemia sp. cultures and proposed the possible ability of LAB to colonise the gut, and to further antagonize pathogens.
Our RAPD-PCR results for LABs indicated a higher degree of genetic diversity among the rods than the cocci when using similarity patterns over 98%. However, other authors have been less rigorous and reported that similarity patterns over a reproducibility level of 83 and 85% were considered genetically similar for LAB from fermentation processes [112,113]. In line with our specified criteria, we selected 16 pLAB (cocci and rods) for 16S rDNA sequencing that allowed us to classify them as LAB, with E. thailandicus being reported for the first time from bullfrog skin, but not the other identified species [39,41].
Interestingly, the same genus and species identified in this work has been isolated from different bullfrog specimens and skin (ventral and dorsal) areas. These findings could be explained by the life-history of hosts, which carry out their biological cycle in aquatic and terrestrial environments, facilitating an ongoing microbiota exchange. Although we detected differences in the probiotic characteristics expressed by isolates of the same genus and species, these are likely due to strain-specific factors. Additional studies are therefore required to identify LAB species at the strain level.
The use of microbial consortia in probiotic formulations would provide advantages over single microorganisms, in part due to the wider range of beneficial functions conferred by a community [114–116]. Our results indicate that all LAB selected as probiotic candidates can be used in the design of a mixed formula, effective against all Bd isolates studied in this work. In this bacterial consortium, each bacterial strain would participate with a specific probiotic property (anti-Bd activity against one or more Bd lineage, and/or characteristics related to adhesion and colonisation) that could potentially act in synergy.
The experimental framework presented here represents the basis to select LAB as probiotics for Bd control, but other in vitro assays such as adhesion to keratin and resistance to amphibian antimicrobial peptides present in the skin mucus must be performed to select suitable LAB for in vivo studies. Considering that bacteria with anti-Bd activity have had variable success for Bd control by bioaugmentation [27], experimental assays with selected LAB strains (alone or in bacterial consortia) must include different amphibian species from diverse geographical regions to guarantee their effectiveness. These studies will allow us to determine long-term persistence of the administered LAB and to propose a specific protocol of LAB administration for a particular amphibian species.
Conclusion
This is the first report on skin-associated LAB from bullfrogs to advance in the design of a probiotic product with applications in Bd control and mitigation. Our analysis of anti-Bd activity and adhesion/colonisation properties have allowed us to select 18 LAB, with E. gallinarum CRL 1826, L. garvieae CRL 1828, P. pentosaceus 15 and 18B being the best probiotic candidates.
Zdroje
1. Catenazzi A. State of the world's amphibians. Annu Rev Environ Resour.2015; 40:91–119.
2. Scheele BC, Pasmans F, Skerratt LF, Berger L, Martel A, Beukema W et al. Amphibian fungal panzootic causes catastrophic and ongoing loss of biodiversity. Science.2019; 363(6434):1459–1463. doi: 10.1126/science.aav0379 30923224
3. Stuart SN, Chanson JS, Cox NA, Young BE, Rodrigues ASL, Fischman DL. The status of the world's land and marine mammals: diversity, threat, and knowledge. Science.2008; 322(5899):225–230. doi: 10.1126/science.1165115 18845749
4. Martel A, Spitzen-van der Sluijs A, Blooi M, Bert W, Ducatelle R, Fisher MC et al. Batrachochytrium salamandrivorans sp. nov. causes lethal chytridiomycosis in amphibians. Proc Natl Acad Sci.2013; 110(38):15325–15329. doi: 10.1073/pnas.1307356110 24003137
5. Longcore JE, Pessier AP, Nichols DK. Batrachochytrium dendrobatidis gen. et sp. nov., a chytrid pathogenic to amphibians. Mycologia.1999; 91:219–227.
6. Gower DJ, Doherty-Bone T, Loader SP, Wilkinson M, Kouete MT, Tapley B et al. Batrachochytrium dendrobatidis infection and lethal chytridiomycosis in caecilian amphibians (Gymnophiona). Ecohealth.2013; 10(2):173–183. doi: 10.1007/s10393-013-0831-9 23677560
7. Rendle M, Tapley B, Perkins M, Bittencourt-Silva G, Gower DJ, Wilkinson M. Itraconazole treatment of Batrachochytrium dendrobatidis (Bd) infection in captive caecilians (Amphibia: Gymnophiona) and the first case of Bd infection in a wild neotropical caecilian. J Zoo Aquar Res.2015; 3(4):137–140.
8. Lambertini C, Becker CG, Bardier C, da Silva Leite D, Toledo LF. Spatial distribution of Batrachochytrium dendrobatidis in South American caecilians. Dis Aquat Organ.2017; 124(2):109–116. doi: 10.3354/dao03114 28425424
9. Berger L, Hyatt AD, Speare R, Longcore JE. Life cycle stages of the amphibian chytrid Batrachochytrium dendrobatidis. Dis Aquat Organ.2005; 68:51–63. doi: 10.3354/dao068051 16465834
10. Voyles J, Young S, Berger L, Campbell C, Voyles WF, Dinudom A et al. Pathogenesis of chytridiomycosis, a cause of catastrophic amphibian declines. Science.2009; 326(5952):582–585. doi: 10.1126/science.1176765 19900897
11. Fites JS, Reinert LK, Chappell TM, Rollins-Smith LA. Inhibition of local immune responses by the frog-killing fungus Batrachochytrium dendrobatidis. Infection and Immunity.2014; 82(11): 4698–4706. doi: 10.1128/IAI.02231-14 25156734
12. Grogan LF, Robert J, Berger L, Skerratt LF, Scheele BC, Castley JG et al. Review of the amphibian immune response to chytridiomycosis, and future directions. Front Immunol.2018; 9:2536. doi: 10.3389/fimmu.2018.02536 30473694
13. Garner TW, Schmidt BR, Martel A, Pasmans F, Muths E, Cunningham AAet al. Mitigating amphibian chytridiomycoses in nature. Philos Trans R Soc Lond B Biol Sci.2016; 371:1709.
14. Antwis RE, Weldon C. Amphibian skin defences show variation in ability to inhibit growth of Batrachochytrium dendrobatidis isolates from the Global Panzootic Lineage. Microbiology. 2017; 63:1835–1838.
15. Greenspan SE, Lambertini C, Carvalho T, James TY, Toledo LF, Haddad CFB et al. Hybrids of amphibian chytrid show high virulence in native hosts. Sci Rep.2018; 8:9600. doi: 10.1038/s41598-018-27828-w 29941894
16. Bosch J, Sanchez-Tomé E, Fernández-Loras A, Oliver JA, Fisher MC, Garner TW. Successful elimination of a lethal wildlife infectious disease in nature. Biol Lett.2015; 11(11):e20150874.
17. Bletz MC, Loudon AH, Becker MH, Bell SC, Woodhams DC, Minbiole KP et al. Mitigating amphibian chytridiomycosis with bioaugmentation: characteristics of effective probiotics and strategies for their selection and use. Ecol Lett.2013; 16(6):807–820. doi: 10.1111/ele.12099 23452227
18. Küng D, Bigler L, Davis LR, Gratwicke B, Griffith E, Woodhams DC. Stability of microbiota facilitated by host immune regulation: informing probiotic strategies to manage amphibian disease. PLoS One.2014; 9(1):e87101. doi: 10.1371/journal.pone.0087101 24489847
19. Rebollar EA, Simonetti SJ, Shoemaker WR, Harris RN. Direct and indirect horizontal transmission of the antifungal probiotic bacterium Janthinobacterium lividum on green frog (Lithobates clamitans) tadpoles. Appl Environ Microbiol.2016; 82:2457–2466. doi: 10.1128/AEM.04147-15 26873311
20. Antwis RE, Preziosi RF, Harrison XA, Garner TW. Amphibian symbiotic bacteria do not show a universal ability to inhibit growth of the global panzootic lineage of Batrachochytrium dendrobatidis.2015; 81(11):3706–3711.
21. Woodhams DC, LaBumbard BC, Barnhart KL, Becker MH, Bletz MC, Escobar LA et al. Prodigiosin, violacein, and volatile organic compounds produced by widespread cutaneous bacteria of amphibians can inhibit two Batrachochytrium fungal pathogens. Microb Ecol.2018; 75(4):1049–1062. doi: 10.1007/s00248-017-1095-7 29119317
22. Brucker RM, Reid N, Harris CR, Gallaher TN, Flaherty DC, Lam BA et al. Amphibian chemical defense: antifungal metabolites of the microsymbiont Janthinobacterium lividum on the salamander Plethodon cinereus. J Chem Ecol.2008; 34:1422–1429. doi: 10.1007/s10886-008-9555-7 18949519
23. Harris RN, Brucker RM, Walke JB, Becker MH, Schwantes CR, Flaherty DC et al. Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus. ISME J.2009; 3(7):818–824. doi: 10.1038/ismej.2009.27 19322245
24. Harris RN, Lauer A, Simon MA, Banning JL, Alford RA. Addition of antifungal skin bacteria to salamanders ameliorates the effects of chytridiomycosis. Dis Aquat Organ.2009; 83(1):11–16. doi: 10.3354/dao02004 19301631
25. Becker MH, Harris RN. Cutaneous bacteria of the redback salamander prevent morbidity associated with a lethal disease. PLoS One.2010; 5(6):e10957. doi: 10.1371/journal.pone.0010957 20532032
26. Park ST, Collingwood AM, St-Hilaire S, Sheridan PP. Inhibition of Batrachochytrium dendrobatidis caused by bacteria isolated from the skin of boreal toads, Anaxyrus (Bufo) boreas boreas, from Grand Teton National Park, Wyoming, USA. Microbiol Insights.2014; 7:1–8. doi: 10.4137/MBI.S13639 24826077
27. Muletz-Wolz CR, DiRenzo GV, Yarwood SA, Campbell Grant EH, Fleischer RC, Lips KR. Antifungal bacteria on woodland salamander skin exhibit high taxonomic diversity and geographic variability. Appl Environ Microbiol.2017; 83(9):e00186–17. doi: 10.1128/AEM.00186-17 28213545
28. Piovia-Scott J, Rejmanek D, Woodhams DC, Worth SJ, Kenny H, McKenzie V et al. Greater species richness of bacterial skin symbionts better suppresses the amphibian fungal pathogen Batrachochytrium dendrobatidis. Microb Ecol.2017; 74(1):217–226. doi: 10.1007/s00248-016-0916-4 28064360
29. Kueneman JG, Woodhams DC, Harris R, Archer HM, Knight R, McKenzie VJ. Probiotic treatment restores protection against lethal fungal infection lost during amphibian captivity. Proc Biol Sci.2016; 283:1839.
30. Lazado CC, Caipang CM. Mucosal immunity and probiotics in fish. Fish Shellfish Immun.2014; 39(1):78–89.
31. Fdhila K, Haddaji N, Chakroun I, Dhiaf A, Macherki MEE, Khouildi B et al. Culture conditions improvement of Crassostrea gigas using a potential probiotic Bacillus sp strain. Microb Pathog.2017; 110:654–658. doi: 10.1016/j.micpath.2017.07.017 28710014
32. Batista S, Medina A, Pires MA, Moriñigo MA, Sansuwan K, Fernandes KJM et al. Innate immune response, intestinal morphology and microbiota changes in Senegalese sole fed plant protein diets with probiotics or autolysed yeast. Appl Microbiol Biotechnol.2016; 100(16):7223–7238. doi: 10.1007/s00253-016-7592-7 27183997
33. Hai NV. The use of probiotics in aquaculture. J Appl Microbiol.2015; 119(4):917–935. doi: 10.1111/jam.12886 26119489
34. Belden LK, Harris RN. Infectious diseases in wildlife: the community ecology context. Front Ecol Environ.2007; 10(5):533–539.
35. Rollins-Smith L, Conlon JM. Antimicrobial peptide defenses against chytridiomycosis, an emerging infectious disease of amphibian populations. Dev Comp Immunol.2005; 29(7):589–598. doi: 10.1016/j.dci.2004.11.004 15784290
36. Toledo RC, Jared C. Cutaneous granular glands and amphibian venoms. Camp Biochem Physiol.1995; 1(1):1–29.
37. Moss AS, Reddy NS, Dortaj IM, San Francisco MJ. Chemotaxis of the amphibian pathogen Batrachochytrium dendrobatidis and its response to a variety of attractants. Mycologia.2008; 100(1):1–5. 18488347
38. Loudon AH, Holland JA, Umile TP, Burzynski EA, Minbiole KP, Harris RN. Interactions between amphibians' symbiotic bacteria cause the production of emergent anti-fungal metabolites. Front Microbiol.2014; 5:441. doi: 10.3389/fmicb.2014.00441 25191317
39. Pasteris SE, Bühler MI, Nader-Macías ME. Microbiological and histological studies in farmed-bullfrog (Rana catesbeiana) displaying red-leg syndrome. Aquaculture.2006; 251:11–18.
40. Pasteris SE, Roig Babot G, Otero MC, Bühler MI, Nader MEF. Beneficial properties of lactic acid bacteria isolated from a Rana castesbeiana hatchery. Aquac Res.2009; 40:1605–1615.
41. Pasteris SE, Vera Pingitore E, Roig Babot G, Otero MC, Bühler MI, Nader-Macías ME. Characterization of the beneficial properties of lactobacilli isolated from bullfrog (Rana catesbeiana) hatchery. Antonie van Leeuwenhoek. 2009; 95:375–385.
42. Pasteris SE, Montel Mendoza G, Llanos RJ, Pucci Alcaide FJ, Nader‐Macías MEF. Preliminary assessment of in vivo safety of potentially probiotic lactic acid bacteria for American bullfrog culture. Aquac Res.2017; 48(5):2157–2172.
43. Montel Mendoza GM, Pasteris SE, Ale CE, Otero MC, Bühler MI, Nader-Macías ME. Cultivable microbiota of Lithobates catesbeianus and advances in the selection of lactic acid bacteria as biological control agents in raniculture. Res Vet Sci.2012; 93:1160–1167. doi: 10.1016/j.rvsc.2012.05.007 22695175
44. Ahmed FE. Genetically modified probiotics in foods. Trends Biotechnol.2003; 21(11):491–497. doi: 10.1016/j.tibtech.2003.09.006 14573362
45. Walter J, Schwab C, Loach DM, Gänzle MG, Tannock GW. Glucosyltransferase A (GtfA) and inulosucrase (Inu) of Lactobacillus reuteri TMW1.106 contribute to cell aggregation, in vitro biofilm formation, and colonization of the mouse gastrointestinal tract. Microbiology.2008; 154: 72–80. doi: 10.1099/mic.0.2007/010637-0 18174127
46. Ventura M, O'Flaherty S, Claesson MJ, Turroni F, Klaenhammer TR, van Sinderen Det al. Genome-scale analyses of health-promoting bacteria: probiogenomics. Nat Rev Microbiol.2009; 7(1):61–71. doi: 10.1038/nrmicro2047 19029955
47. Fusco V, Quero GM, Cho GS, Kabisch J, Meske D, Neve H et al. The genus Weissella: taxonomy, ecology and biotechnological potential. Front Microbiol.2015; 6:155. doi: 10.3389/fmicb.2015.00155 25852652
48. Reid G, Sanders ME, Gaskins HR, Gibson GR, Mercenier A, Rastall R et al. New scientific paradigms for probiotics and prebiotics. J Clin Gastroenterol.2003; 37(2):105–118. doi: 10.1097/00004836-200308000-00004 12869879
49. European Food Safety Authority. EFSA Journal 2008; 732:1–15.
50. Zorriehzahra MJ, Delshad ST, Adel M, Tiwari R, Karthik K, Dhama K et al. Probiotics as beneficial microbes in aquaculture: an update on their multiple modes of action: a review. Vet Q.2016; 36(4):228–241. doi: 10.1080/01652176.2016.1172132 27075688
51. Gao X, Zhang M, Li X, Han Y, Wu F, Liu Y. The effects of feeding Lactobacillus pentosus on growth, immunity, and disease resistance in Haliotis discus hannai Ino. Fish Shellfish Immun.2018; 78:42–51.
52. Ringø E, Hoseinifar SH, Ghosh K, Doan HV, Beck BR, Song SK. Lactic acid bacteria in finfish-an update. Front Microbiol.2018; 9:1818. doi: 10.3389/fmicb.2018.01818 30147679
53. Quintana G, Niederle MV, Minahk CJ, Picariello G, Nader-Macías MEF, Pasteris SE. Nisin Z produced by Lactococcus lactis from bullfrog hatchery is active against Citrobacter freundii, a red-leg syndrome related pathogen. World J Microbiol Biotechnol.2017; 33:186. doi: 10.1007/s11274-017-2353-z 28956240
54. Sarika AR, Lipton AP, Aishwarya MS, Rachana Mol RS. Lactic acid bacteria from marine fish: antimicrobial resistance and production of bacteriocin effective against L. monocytogenes in situ. J Food Microbiol Saf Hyg.2017; 2:4.
55. Digaitiene A, Hansen ÅS, Juodeikiene G, Eidukonyte D, Josephsen J. Lactic acid bacteria isolated from rye sourdoughs produce bacteriocin-like inhibitory substances active against Bacillus subtilis and fungi. J App Microbiol.2012; 112(4):732–742.
56. Graham CE, Cruz MR, Garsin DA, Lorenz MC. Enterococcus faecalis bacteriocin EntV inhibits hyphal morphogenesis, biofilm formation, and virulence of Candida albicans. Proc Natl Acad Sci USA.2017; 114(17):4507–4512. doi: 10.1073/pnas.1620432114 28396417
57. Ringø E, Løvmo L, Kristiansen M, Bakken Y, Salinas I, Myklebust R et al. Lactic acid bacteria vs. pathogens in the gastrointestinal tract of fish: A review. J Aquac Res Dev. 2010; 41:451–467.
58. Kaktcham PM, Temgoua JB, Zambou FN, Diaz-Ruiz G, Wacher C, Pérez-Chabela ML. In vitro evaluation of the probiotic and safety properties of bacteriocinogenic and non-bacteriocinogenic lactic acid bacteria from the intestines of Nile tilapia and common carp for their use as probiotics in aquaculture. Probiotics Antimicrob Proteins.2018; 10(1):98–109. doi: 10.1007/s12602-017-9312-8 28752423
59. Leccese Terraf MC, Mendoza LM, Juárez Tomás MS, Silva C, Nader-Macías ME. Phenotypic surface properties (aggregation, adhesion and biofilm formation) and presence of related genes in beneficial vaginal lactobacilli. J Appl Microbiol.2014; 117(6):1761–1772. doi: 10.1111/jam.12642 25195810
60. Živković M, Miljković MS, Ruas-Madiedo P, Markelić MB, Veljović K, Tolinački M et al. EPS-SJ exopolysaccharide produced by the strain Lactobacillus paracasei subsp. paracasei BGSJ2-8 is involved in adhesion to epithelial intestinal cells and decrease on E. coli association to Caco-2 cells. Front Microbiol.2016; 7:286. doi: 10.3389/fmicb.2016.00286 27014210
61. Watters C, Fleming D, Bishop D, Rumbaugh KP. Host responses to biofilm. Prog Mol Biol Transl Sci. 2016; 142:193–239. doi: 10.1016/bs.pmbts.2016.05.007 27571696
62. Amaral-Machado L, Xavier-Júnior FH, Rutckeviski R, Morais AR, Alencar ÉN, Dantas TRet al. New trends on antineoplastic therapy research: bullfrog (Rana catesbeiana Shaw) oil nanostructured systems. Molecules.2016; 21(5).
63. Garner TW, Perkins MW, Govindarajulu P, Seglie D, Walker S, Cunningham AAet al. The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana. Biol Lett.2006; 2(3):455–459. doi: 10.1098/rsbl.2006.0494 17148429
64. Schloegel LM, Ferreira CM, James TY, Hipolito M, Longcore J. E., Hyatt A. D. et al. The North American bullfrog as a reservoir for the spread of Batrachochytrium dendrobatidis in Brazil. Anim Conserv.2009;13(s1):53–61.
65. Bataille A, Fong JJ, Cha M, Wogan GOU, Baek HJ, Lee H et al. Genetic evidence for a high diversity and wide distribution of endemic strains of the pathogenic chytrid fungus Batrachochytrium dendrobatidis in wild Asian amphibians. Mol Ecol.2013; 22(16):4196–4209. doi: 10.1111/mec.12385 23802586
66. Schloegel LM, Toledo LF, Longcore JE, Greenspan SE, Vieira CA, Lee M et al. Novel, panzootic and hybrid genotypes of amphibian chytridiomycosis associated with the bullfrog trade. Mol Ecol 2012; 21(21):5162–5177. doi: 10.1111/j.1365-294X.2012.05710.x 22857789
67. FAO/WHO (2001) Health and nutritional properties of probiotics in food including powder milk with live lactic acid bacteria. http://www.who.int/foodsafety/publications/fs_management/en/probiotics.pd
68. de Man JC, Rogosa M, Sharpe ME. Medium for the cultivation of lactobacilli. J App Bacteriol.1960; 23:130–135.
69. Rosenblum EB, James TY, Zamudio KR, Poorten TJ, Ilut D, Rodriguez D et al. Complex history of the amphibian-killing chytrid fungus revealed with genome resequencing data. Proc Natl Acad Sci USA.2013; 110(23):9385–9390. doi: 10.1073/pnas.1300130110 23650365
70. Mesquita AFC, Lambertini C, Lyra M, Malagoli LR, James TY, Toledo LFet al. Low resistance to chytridiomycosis in direct-developing amphibians. Sci Rep.2017; 7(1):16605. doi: 10.1038/s41598-017-16425-y 29192210
71. Valenzuela-Sánchez A, O'Hanlon SJ, Alvarado-Rybak M, Uribe-Rivera DE, Cunningham AA, Fisher MC et al. Genomic epidemiology of the emerging pathogen Batrachochytrium dendrobatidis from native and invasive amphibian species in Chile. Transbound Emerg Dis.2018; 65(2):309–314. doi: 10.1111/tbed.12775 29205924
72. O'Hanlon SJ, Rieux A, Farrer RA, Rosa GM, Waldman B, Bataille A et al. Recent Asian origin of chytrid fungi causing global amphibian declines. Science.2018; 360(6389):621–627. doi: 10.1126/science.aar1965 29748278
73. Rosenberg M, Doyle RJ. Microbial cell surface hydrophobicity: History, measurement, and significance. MBio.1990; 1–38.
74. Freeman DJ, Falkiner FR, Keane CT. New method for detecting slime production by coagulase negative staphylococci. J Clin Pathol.1989; 42:872–874. doi: 10.1136/jcp.42.8.872 2475530
75. Mozzi F, Gerbino E, Font de Valdez G, Torino MI. Functionality of exopolysaccharides produced by lactic acid bacteria in an in vitro gastric system. J Appl Microbiol.2009; 107(1):56–64. doi: 10.1111/j.1365-2672.2009.04182.x 19291238
76. Leccese Terraf MC, Juárez Tomás MS, Nader-Macías ME, Silva C. Screening of biofilm formation by beneficial vaginal lactobacilli and influence of culture media components. J Appl Microbiol.2012; 113(6):1517–1529. doi: 10.1111/j.1365-2672.2012.05429.x 22897406
77. Borges SF, Silva JG, Teixeira PC. Survival and biofilm formation of Listeria monocytogenes in simulated vaginal fluid: influence of pH and strain origin. FEMS Immunol Med Microbiol.2011; 62(3):315–320. doi: 10.1111/j.1574-695X.2011.00815.x 21569122
78. Reyes-Escogido L, Balam-Chi M, Rodríguez-Buenfil I, Valdés J, Kameyama L, Martínez-Pérez F. Purification of bacterial genomic DNA in less than 20 min using chelex-100 microwave: examples from strains of lactic acid bacteria isolated from soil samples. Antonie van Leeuwenhoek.2010; 98(4):465–474. doi: 10.1007/s10482-010-9462-0 20556655
79. Fraga J, Pelayo L, Sariego I, Rojas L, Nuñez FA. RAPD technique: Obtention genetic markers of pathogenesis in infections by Trichomonas vaginalis and Giardia lamblia. Rev Soc Ven Microbiol.2004; 24(1):238–245.
80. Huey B, Hall J. Hypervariable DNA fingerprinting in Escherichia coli: minisatellite probe from bacteriophage M13. J Bacteriol.1989; 171(5):2528–2532. doi: 10.1128/jb.171.5.2528-2532.1989 2565332
81. Heras J, Domínguez C, Mata E, Pascual V, Lozano C, Torres C et al. Gel J–a tool for analysing DNA fingerprint gel images. BMC Bioinformatics.2015; 16:270. doi: 10.1186/s12859-015-0703-0 26307353
82. Pospiech A, Neumann B. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet.1995; 11(6):217–218. doi: 10.1016/s0168-9525(00)89052-6 7638902
83. Kullen MJ, Sanozky-Dawes RB, Crowell DC, Klaenhammer TR. Use of the DNA sequence of variable regions of the 16S rRNA gene for rapid and accurate identification of bacteria in the Lactobacillus acidophilus complex. J Appl Microbiol.2000; 89:511–516. doi: 10.1046/j.1365-2672.2000.01146.x 11021584
84. Becker MH, Walke JB, Cikanek S, Savage AE, Mattheus N, Santiago CNet al. Composition of symbiotic bacteria predicts survival in Panamanian golden frogs infected with a lethal fungus. Proc R Soc Lond.2015; 282: 20142881.
85. Becker MH, Walke JB, Murrill L, Woodhams DC, Reinert LK, Rollins-Smith LAet al. Phylogenetic distribution of symbiotic bacteria from Panamanian amphibians that inhibit growth of the lethal fungal pathogen Batrachochytrium dendrobatidis. Mol Ecol.2015; 24:1628–1641. doi: 10.1111/mec.13135 25737297
86. Antwis RE, Harrison XA. Probiotic consortia are not uniformly effective against different amphibian chytrid pathogen isolates. Mol Ecol.2017; 27(2):577–589.
87. Linley E, Denyer SP, McDonnell G, Simons C, Maillard JY. Use of hydrogen peroxide as a biocide: new consideration of its mechanisms of biocidal action. J Antimicrob Chemother.2012; 67:1589–1596. doi: 10.1093/jac/dks129 22532463
88. Guimarães A, Venancio A, Abrunhosa L. Antifungal effect of organic acids from lactic acid bacteria on Penicillium nordicum. Food Addit Contam Part A Chem Anal Control Expo Risk Assess.2018; 35(9):1803–1818. doi: 10.1080/19440049.2018.1500718 30016195
89. Van Rooij P, Pasmans F, Coen Y, Martel A. Efficacy of chemical disinfectants for the containment of the salamander chytrid fungus Batrachochytrium salamandrivorans. PLoS One.2017; 12(10):e0186269. doi: 10.1371/journal.pone.0186269 29023562
90. Woodhams DC, Bletz M, Kueneman J, McKenzie V. Managing amphibian disease with skin microbiota. Trends Microbiol.2016; 24(3):161–164. doi: 10.1016/j.tim.2015.12.010 26916805
91. Ly MH, Vo H, Le TM, Belin JM, Waché Y. Diversity of the surface properties of lactococci and consequences on adhesion to food components. Colloids Surf B Biointerfaces.2006; 52(2):149–153. doi: 10.1016/j.colsurfb.2006.04.015 16844359
92. Etzold S, Juge N. Structural insights into bacterial recognition of intestinal mucins. Curr Opin Struct Biol.2014; 28:23–31. doi: 10.1016/j.sbi.2014.07.002 25106027
93. Mercier-Bonin M, Chapot-Chartier M-P. Surface proteins of Lactococcus lactis: bacterial resources for muco-adhesion in the gastrointestinal tract. Front Microbiol.2017; 8:2247. doi: 10.3389/fmicb.2017.02247 29218032
94. Ofek I, Doyle R. Methods, models and analysis of bacterial adhesion. In: Ofek I, Doyle R, editors. Bacterial adhesion to cells and tissues. Chapman and Hall, New York.1994. pp.16–20.
95. Sánchez-Ortiz AC, Luna-González A, Campa-Córdova A I, Escamilla-Montes R, Flores-Miranda MC, Mazón-Suástegui JM. Isolation and characterization of potential probiotic bacteria from pustulose ark (Anadara tuberculosa) suitable for shrimp farming. Lat Am J Aquat Res.2015; 43(1):123–136.
96. Fontana C, Cocconcelli PS, Vignolo G. Direct molecular approach to monitoring bacterial colonization on vacuum-packaged beef. Appl Environ Microbiol. 2006; 72(8):5618–5622. doi: 10.1128/AEM.00029-06 16885317
97. Berger L, Hyatt AD, Speare R, Longcore JE. Life cycle stages of the amphibian chytrid Batrachochytrium dendrobatidis. Dis Aquat Organ.2005; 68:51–63. doi: 10.3354/dao068051 16465834
98. Otero MC, Ocaña VS, Nader-Macías ME. Bacterial surface characteristics applied to selection of probiotic microorganisms. Methods Mol Biol. 2004; 268:435–440. doi: 10.1385/1-59259-766-1:435 15156054
99. Servin AL. Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens. FEMS Microbiol Rev.2004; 28:405–440. doi: 10.1016/j.femsre.2004.01.003 15374659
100. Lebeer S, Verhoeven SLA, Francius G, Schoofs G, Lambrichts I, Dufrêne Y. Identification of a gene cluster for the biosynthesis of a long, galactose-rich exopolysaccharide in Lactobacillus rhamnosus GG and functional analysis of the priming glycosyltransferase. Appl Environ Microbiol.2009; 75(11): 3554–3563. doi: 10.1128/AEM.02919-08 19346339
101. Wang X, Shao C, Liu L, Guo X, Xu Y, Lü X et al. Optimization, partial characterization and antioxidant activity of an exopolysaccharide from Lactobacillus plantarum KX041. Int J Biol Macromol.2017; 103:1173–1184. doi: 10.1016/j.ijbiomac.2017.05.118 28551435
102. Tu NHK, Dat NV, Canh LV, Vinh DTT. Detection of the potential inactivation of Tetrodotoxin by lactic acid bacterial exopolysaccharide. Toxins.2018; 10(7).
103. Puertas AI, Ibarburua I, Elizaquivel P, Zuriarraina A, Berregia I, López P. Disclosing diversity of exopolysaccharide-producing lactobacilli from Spanish natural ciders. Int J Food Sci Technol.2018; 90:469–474.
104. Ruas-Madiedo P, Gueimonde M, Margolles A, de los Reyes-Gavilán CG, Salminen S. Exopolysaccharides produced by probiotic strains modifies the adhesion of probiotics and enteropathogens to human intestinal mucus. J Food Prot.2006; 69:2011–2015. doi: 10.4315/0362-028x-69.8.2011 16924934
105. Polak-Berecka M, Wa´sko A, Paduch R, Skrzypek T, Sroka-Bartnicka A. The effect of cell surface components on adhesion ability of Lactobacillus rhamnosus. Antonie van Leeuwenhoek.2014; 106: 751–762. doi: 10.1007/s10482-014-0245-x 25090959
106. Dertli E, Mayer MJ Narbad A. Impact of the exopolysaccharide layer on biofilms, adhesion and resistance to stress in Lactobacillus johnsonii FI9785. BMC Microbiol.2015; 15:8. doi: 10.1186/s12866-015-0347-2 25648083
107. Martín R, Soberón N, Vaneechoutte M, Flórez AB, Vázquez F, Suárez JE. Characterization of indigenous vaginal lactobacilli from healthy women as probiotic candidates. Int Microbiol.2008; 11:261–266. doi: 10.2436/20.1501.01.70 19204898
108. Borisa S, Barbés C. Role played by lactobacilli in controlling the population of vaginal pathogens. Microbes Infect.2017; 2(5):543–546.
109. Rickard AH, Gilbert P, High NJ, Kolenbrander PE, Handley PS. Bacterial coaggregation: an integral process in the development of multi-species biofilms. Trends Microbiol.2003; 11: 94–100. doi: 10.1016/s0966-842x(02)00034-3 12598132
110. Lebeer S, Verhoeven TLA, Perea Velez M, Vanderleyden J, De Keersmaecker SCJ. Impact of environmental and genetic factors on biofilm formation by the probiotic strain Lactobacillus rhamnosus GG. J Appl Environ Microbiol.2007; 73(21):6768–6775.
111. Lamari F, Mahdhi A, Chakroun I, Esteban MA, Mazurais D, Amina B et al. Interactions between candidate probiotics and the immune and antioxidative responses of European sea bass (Dicentrarchus labrax) larvae. J Fish Dis.2016; (39):1421–1432.
112. Silva LF, Casella T, Gomes ES, Nogueira MC, De Dea Lindner J, Penna AL. Diversity of lactic acid bacteria isolated from Brazilian water buffalo mozzarella cheese. J Food Sci.2015; 80(2):M411–417. doi: 10.1111/1750-3841.12771 25597646
113. Touret T, Oliveira M, Semedo-Lemssaddek T. Putative probiotic lactic acid bacteria isolated from sauerkraut fermentations. PLoS One.2018; 13(9):e0203501. doi: 10.1371/journal.pone.0203501 30192827
114. Mastromarino P, Capobianco D, Miccheli A, Praticò G, Campagna G, Laforgia N et al. Administration of a multistrain probiotic product (VSL#3) to women in the perinatal period differentially affects breast milk beneficial microbiota in relation to mode of delivery. Pharmacol Res.2015; (95–96):63–70.
115. Virchenko OV, Falalyeyeva TM, Beregova TV, Spivak MY, Lazarenko LM, Demchenko OM. Effects of mono-, poly- and composite probiotics on the ulceration caused by restraint stress. Fiziol Zh. 2015; 61(1):35–41. 26040033
116. Kobyliak N, Falalyeyeva T, Virchenko O, Mykhalchyshyn G, Bodnar P, Spivak M et al. Comparative experimental investigation on the efficacy of mono- and multiprobiotic strains in non-alcoholic fatty liver disease prevention. BMC Gastroenterol.2016; 16:34. doi: 10.1186/s12876-016-0451-2 26976285
Článek vyšel v časopise
PLOS One
2019 Číslo 9
- Přerušovaný půst může mít významná zdravotní rizika
- Prázdné kalorie, inteligentní brýle, neviditelné pláště a lidoopí genom – „jednohubky“ z výzkumu 2025/15
- Hodné, zlé nebo ošklivé? Jak je na tom vejce?
- Jak lékaře i další zdravotníky ohrožuje únava ze soucitu
- Top zaměstnavatelé ve zdravotnictví si hýčkají už studenty
Nejčtenější v tomto čísle
- Graviola (Annona muricata) attenuates behavioural alterations and testicular oxidative stress induced by streptozotocin in diabetic rats
- CH(II), a cerebroprotein hydrolysate, exhibits potential neuro-protective effect on Alzheimer’s disease
- Comparison between Aptima Assays (Hologic) and the Allplex STI Essential Assay (Seegene) for the diagnosis of Sexually transmitted infections
- Assessment of glucose-6-phosphate dehydrogenase activity using CareStart G6PD rapid diagnostic test and associated genetic variants in Plasmodium vivax malaria endemic setting in Mauritania