-
Články
- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Kariéra
Doporučené pozice
Reklama- Praxe
Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
Authors: Wim Trypsteen aff001; Cory H. White aff002; Amey Mukim aff003; Celsa A. Spina aff003; Ward De Spiegelaere aff005; Steve Lefever aff006; Vicente Planelles aff007; Alberto Bosque aff008; Christopher H. Woelk aff002; Linos Vandekerckhove aff001; Nadejda Beliakova-Bethell aff003
Authors place of work: HIV Cure Research Center, Department of Internal Medicine, Ghent University and Ghent University Hospital, Ghent, Belgium aff001; Faculty of Medicine, University of Southampton, Southampton, Hants, United Kingdom aff002; San Diego VA Medical Center and Veterans Medical Research Foundation, San Diego, CA, United States of America aff003; Department of Pathology, University of California San Diego, La Jolla, CA, United States of America aff004; Department of Morphology, Faculty of Veterinary Sciences, Ghent University, Ghent, Belgium aff005; Center for Medical Genetics, Ghent University, Ghent, Belgium aff006; Division of Microbiology and Immunology, Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT, United States of America aff007; Department of Microbiology, Immunology and Tropical Medicine, The George Washington University, Washington, DC, United States of America aff008; Department of Medicine, University of California San Diego, La Jolla, CA, United States of America aff009
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0224879Summary
The latent cellular reservoir of HIV is recognized as the major barrier to cure from HIV infection. Long non-coding RNAs (lncRNAs) are more tissue and cell type-specific than protein coding genes, and may represent targets of choice for HIV latency reversal. Using two in vitro primary T-cell models, we identified lncRNAs dysregulated in latency. PVT1 and RP11-347C18.3 were up-regulated in common between the two models, and RP11-539L10.2 was down-regulated. The major component of the latent HIV reservoir, memory CD4+ T-cells, had higher expression of these lncRNAs, compared to naïve T-cells. Guilt-by-association analysis demonstrated that lncRNAs dysregulated in latency were associated with several cellular pathways implicated in HIV latency establishment and maintenance: proteasome, spliceosome, p53 signaling, and mammalian target of rapamycin (MTOR). PVT1, RP11-347C18.3, and RP11-539L10.2 were down-regulated by latency reversing agents, suberoylanilide hydroxamic acid and Romidepsin, suggesting that modulation of lncRNAs is a possible secondary mechanism of action of these compounds. These results will facilitate prioritization of lncRNAs for evaluation as targets for HIV latency reversal. Importantly, our study provides insights into regulatory function of lncRNA during latent HIV infection.
Keywords:
Gene expression – T cells – HIV infections – Proteasomes – Long non-coding RNAs – Viral persistence and latency – Spliceosomes
Introduction
In the present era of combination anti-retroviral therapy (cART), the latent cellular reservoir of HIV is recognized as the major barrier to a cure [1–3]. Existing latency reversing agents (LRAs) are suboptimal to induce a sustained reduction of the latent reservoir in vivo and suffer from lack of specificity for HIV [4]. Long non-coding RNAs (lncRNAs) may present targets of choice for HIV latency reversal because they are more tissue and cell-type specific than protein coding genes [5] and can be accurately targeted by oligonucleotides.
Though the role of individual lncRNAs in regulation of HIV expression and their possible contribution to HIV latency control has been recognized, the number of lncRNAs that were studied in this setting is limited. For example, siRNA-mediated knockdown or CRISPR-Cas9-induced knockout of Nuclear Paraspeckle Assembly Transcript 1 (NEAT1) resulted in enhanced HIV replication and an increase of unspliced and singly-spliced HIV RNA in the cytoplasmic fraction [6, 7], consistent with a possible role of NEAT1 in HIV RNA nuclear retention. Although these experiments were performed using productively infected cell lines [6], the results from this study suggested a possible role for NEAT1 in post-transcriptional regulation of HIV latency via nuclear retention of HIV transcripts, warranting further investigation in appropriate model systems. Another example is Non-Protein Coding RNA, Repressor of NFAT (NRON), whose function in HIV latency control was demonstrated using an in vitro model of HIV latency and cells from HIV-infected patients receiving cART [8]. NRON promoted HIV latency by recruiting the transactivator protein Tat to the proteasome for degradation; knockdown of NRON resulted in reactivation of the latent provirus [8]. In addition, NRON may also regulate HIV replication via cytoplasmic retention of nuclear factor of activated T-cells (NFAT) [9], which enhances HIV transcription in primary CD4+ T-cells [10]. In contrast, MALAT1 and uc002yug.2 lncRNAs were shown to be positive regulators of HIV replication [11, 12]. MALAT1 sequestered polycomb repressive complex 2 from the HIV LTR, promoting its transcriptionally active state [12]. Uc002yug.2 functioned via up-regulation of Tat and down-regulation of HIV transcriptional repressors Runx1b and Runx1c; overexpression of uc002yug.2 in cells from HIV-infected patients on cART improved HIV reactivation following treatment with phytohemagglutinin M [11]. Because lncRNAs represent a greater fraction of the transcribed human genome than protein coding genes [13], it is plausible to hypothesize that there are more lncRNAs than currently demonstrated that participate in regulation of HIV expression and may contribute to HIV latency.
To-date, very few studies have attempted to explore the complexity of host-HIV interactions in the context of lncRNA expression and function. We and others have previously profiled the entire transcriptome, including lncRNAs, at different time points following HIV infection in the SupT1 cell line [14, 15]. Peng and colleagues demonstrated that early response to HIV infection included changes in expression of many lncRNA, some of which were independent of active HIV replication [15]. We further expanded on this study to explore changes in lncRNA expression during different stages of the HIV replication cycle, including reverse transcription, integration and particle production [14]. Guilt-by-association (GBA) analysis demonstrated that dysregulated lncRNAs were functionally linked to many pathways involved in regulation of T-cell function and anti-viral responses [14, 15], consistent with the idea that lncRNAs represent a part of the host response to HIV infection and may be involved in regulation of induced cellular pathways.
To our knowledge, lncRNAs have not been previously profiled during latent HIV infection in primary CD4+ T cells. In the present study, we sought to identify lncRNA dysregulated in two relevant primary T-cell models of HIV latency using RNA-Seq. The models that use replication-competent wild type HIV virus were selected in order to recapitulate more closely the effects of latency in vivo. Because latency is preferentially established in memory compared to naïve cells, we further aimed to determine the relationship between expression levels of lncRNAs dysregulated in latency and CD4+ T-cell maturation state. To infer the function of dysregulated lncRNA in HIV latency establishment and maintenance, we performed GBA analysis that identifies cellular pathways associated with lncRNAs. Finally, we aimed to determine whether the selected dysregulated lncRNAs are modulated by small molecule LRAs suberoylamilide hydroxamic acid (SAHA) and Romidepsin (RMD), and whether effects of SAHA and RMD on lncRNA may represent novel secondary mechanisms of action of these compounds with respect to HIV reactivation. The main motivation behind the present study was prioritization of candidate lncRNAs for further formal evaluation as targets for therapies aimed at eradication of the latent HIV reservoir.
Results
Models of HIV latency
To identify lncRNAs dysregulated in HIV latency, the cultured TCM [16, 17] and the bystander model [18, 19] of HIV latency were used. These models differ by the phenotypic composition of CD4+ T-cells and the route of latency establishment (dividing cells returning to quiescence or resting cells). Cultured TCM model originally developed by Bosque and Planelles [16, 17] is established over 17 days of culture, where initial infection is conducted by spinoculation after 7 days following cell activation and expansion. Further virus replication and transmission is facilitated via cell-to-cell contact during the crowding stage till day 13, when the peak of p24+ expression is observed (21.8 ± 7.8 percent p24+ cells, N = 4). Virus spread is stopped at this point by adding antiretrovirals, and cells are allowed to return to quiescence for another 4 days [20]. Before samples are processed for sequencing, positive magnetic isolation of CD4+ T cells is used to sort out cells that may be productively infected [21]. Integration events in this model were characterized previously using Alu-PCR [21] detecting 33 ± 10.6% cells with HIV provirus on day 17, on average (N = 5), assuming 160 cells generate 1 ng DNA. “Bystander” model, described in [18] and [19], uses a shorter culture period, where a subset of cells is initially stained with a viable dye, e-Fluor 670, infected with HIV and activated, followed by mixing of these cells with resting “bystander” cells. Resting bystander cells are represented by all major phenotypic subsets found in vivo, including naïve, central memory and effector memory cells. Virus transmission from infected proliferating to bystander cells occurs in this co-culture via cell-to-cell contact. Peak of infection (average 37.3 ± 10.4 percent of p24+ proliferating cells, N = 4) is achieved on day 7. At this point, the resting (e-Fluor 670 negative) bystander cells are sorted out from the co-culture by fluorescence activated cell sorting. Following separation from productively infected cells, resting cells are left in culture for another 3 days to complete integration events of virus that entered the cells. Integration events in the end of culture were evaluated previously by droplet digital PCR (ddPCR) [19], detecting 14.9 ± 6% cells with HIV provirus on day 10, on average (N = 4). HIV RNA was detectable in both models at the time of RNA-Seq analysis, and increased following treatments that are used to reactivate HIV out of latency [19, 21]. In addition, a small percentage of cells generated by each of the models, without any reactivation stimuli, is p24+ (average 1.5 ± 1.2 percent and 1.8 ± 1.3 percent for bystander and cultured TCM models, respectively, N = 4). A diagram in Fig 1 shows a side-by-side comparison of the key events during the establishment of each model.
Fig. 1. Comparison of the time-line of latency establishment between cultured TCM and bystander models. Cells during activation stage are depicted with darker grey color. Resting cells are presented in light grey. Gradient of color for the cultured TCM model represents gradual return from activation to quiescence. Major steps during model set-up (such as infection and sorting) are indicated above the time-line. To identify genes dysregulated in latency, both TCM and bystander models were compared to “mock-infected” cells cultured in parallel. These cells underwent the same exposure to activation stimuli, spin-infection, crowding and ART treatment (in case of cultured TCM), or exposure to proliferating cells (in case on bystander model) as their infected counterparts. This design allowed us to control for exposure of cells to cytokines and chemokines in the co-culture. Data from the cultured TCM model was analyzed previously [21] identifying a total of 826 differentially expressed genes between mock-infected cells and the cells from the model of HIV latency. The bystander model was analyzed as part of the present study identifying 618 differentially expressed genes. To test the effect of the exposure to the virus on gene expression, gene expression signatures of latently infected cells were compared with a list of interferon stimulated genes with known antiviral properties [22]. This analysis identified 11 interferon stimulated genes (out of 826 total genes) for the cultured TCM model and was described previously [21]. In the present study, bystander model was assessed in a similar manner, and only one interferon stimulated gene (APOBEC3H) was differentially expressed out of 618 total genes. We also found two upregulated DNA sensors [23], NLR family pyrin domain containing 3 (NLRP3) and pyrin and HIN domain family member 1 (PYHIN1), in cultured TCM model only. Overall, these evaluations suggest that exposure to virus had minimal effect on gene expression at the time of the assay, and it may be more pronounced in the cultured TCM compared to the bystander model.
Identification of lncRNAs dysregulated in the models of HIV latency
Identified differentially expressed genes were annotated as protein coding or non-coding based on their types (e.g. intergenic, antisense, etc.), in both datasets (Tables 1 and S1). Differentially expressed lncRNAs represented 115 (13.9%) and 147 (23.8%) of all differentially expressed genes in the cultured TCM and the bystander models, respectively. The majority of dysregulated lncRNA was up-regulated in both models and originated from intergenic or antisense classes, consistent with genome distribution of different lncRNA types (Fig 2). Intronic lncRNAs were over-represented among lncRNAs dysregulated in latency (cultured TCM model: OR = 2.36, p = 0.02; bystander model: OR = 3.85, p<0.01). Differentially expressed genes and lncRNAs in each of the models of HIV latency were then compared, identifying 92 protein coding genes and 10 lncRNAs that were dysregulated in both models (S1 Fig). All dysregulated lncRNA were consistently either up - or down-regulated in both models (Table 2).
Fig. 2. Overview of differentially expressed lncRNAs in the cultured TCM and the bystander models of HIV latency. (A) Volcano plots showing all lncRNAs (grey dots). Significantly up-regulated lncRNAs (red dots) and down-regulated lncRNAs (blue dots) are highlighted for both latency models. (B) Heatmaps of differentially expressed lncRNAs. (C) Number of differentially expressed mRNAs, pseudogenes, TR_V genes, and lncRNAs, and percentages of lncRNAs of different types out of the total dysregulated lncRNAs. Tab. 1. Overview of differentially expressed protein coding genes and lncRNAs. Tab. 2. LncRNAs dysregulated in common between the cultured TCM and the bystander model. Validation of expression of lncRNA by ddPCR
Though an overlapping set of dysregulated lncRNAs was identified using RNA-Seq, the difference in expression of lncRNAs between the model of latency and mock-infected cells was frequently less than the effect size of the RNA-Seq experiment (effect size ≈1.5 with N = 4 biological replicates). Small differences in expression were not unexpected because each model of HIV latency is comprised of the mixture of uninfected and latently infected cells, with latently infected cells ranging from 8.8% to 44.3% [19, 21] (defined as percentage of cells with HIV provirus). Therefore, we aimed to use a method independent of RNA-Seq to validate expression of a set of overlapping lncRNAs. DdPCR was chosen for this purpose, because it is the most sensitive technique for detection of small differences in gene expression. Four lncRNAs, PVT1 oncogene (Ensembl ID ENSG00000249859), RP11-347C18.3 (Ensembl ID ENSG00000253878), RP11-539L10.2 (Ensembl ID ENSG00000246526) and NEAT1 (Ensembl ID ENSG00000245532), were selected for validation. Same samples that were sequenced, and three additional sample pairs for the bystander model were analyzed. Up-regulation of PVT1 and RP11-347C18.3 was confirmed both in the cultured TCM and the bystander models (cultured TCM model: PVT1 average fold change 1.8, p = 0.02; RP11-347C18.3 average fold change 2.95, p = 0.01; bystander model: PVT1 average fold change 1.33, p = 0.02; RP11-347C18.3 average fold change 2.12, p = 0.0002) (S2 Fig). Down-regulation of RP11-539L10.2 was confirmed in the bystander model (average fold change -1.28, p = 0.046) (S2 Fig). Up-regulation of NEAT1 was not confirmed in either of the models, neither with the assay that detects both short and long isoforms (N1+N2), nor the long isoform-specific assay (N2) (S2 Fig).
Neither of the RNA-Seq datasets contained the Ensembl identifier for lncRNA NRON (ENSG00000253079), possibly because it was not present in the reference files used for mapping and counting RNA-Seq reads. Because NRON represents the only lncRNA whose function in maintaining HIV in latent state has been demonstrated in a primary T-cell model system and cell from HIV-infected individuals [8], we measured the expression of NRON using ddPCR. Despite the previous report of a relatively high expression of this lncRNA in primary CD4+ T-cells [8], we observed relatively low expression, two orders of magnitude lower than of the other lncRNAs measured. For the cultured TCM model, there was sufficient amount of RNA to measure NRON from only three out of four sequenced sample pairs. In these three donors, NRON was strongly and significantly up-regulated (average fold change 4.2, p = 0.003) in the model of latency compared to mock-infected cells (S2 Fig). Though in some cases NRON was up-regulated in the bystander model, up-regulation was modest (average fold change 1.2 for four donors and 1.1 for 7 donors) and not consistent among the seven replicate experiments (S2 Fig). Thus, though up-regulation of NRON in latency may be used as validation of our approach of identifying lncRNAs that function in latency control, the discrepant results for NRON between the two models are consistent with the idea that route of latency establishment and cell composition may contribute to the mechanisms by which latency is regulated.
LncRNAs dysregulated in the models of HIV latency have higher expression in memory compared to naïve T-cells
Memory cells are considered to be the major reservoir of latent HIV provirus [24–28]. If a host factor functions to promote HIV latency, its expression would likely be higher in memory than in TN cells. Indeed, an HIV repressor, Blimp-1 (gene symbol PRDM1) was expressed at significantly higher levels in TCM than in TN cells [29]. Therefore, to further assess whether identified lncRNAs likely function in latency control, we measured the expression of PVT1, RP11-347C18.3, RP11-539L10.2 and NRON in TN and memory cell subsets, including TCM and TEM cells. Uninfected cells sorted into major phenotypic subsets were used for this experiment. While PVT1 and RP11-347C18.3 were up-regulated and RP11-539L10.2 was down-regulated in latency, expression of all three lncRNAs was significantly higher in TCM and TEM compared to TN cells (Figs 3 and S3). Specifically, PVT1 expression was on average 3-fold higher in TCM than TN cells (N = 6, p = 0.0005); and on average 2.8-fold higher in TEM than TN cells (N = 4, p<0.0001). RP11-347C18.3 expression was on average 2-fold higher in TCM (N = 6, p<0.0001) or TEM (N = 4, p<0.0001) than TN cells. RP11-539L10.2 expression was on average 6.6-fold higher in TCM than TN cells (N = 6, p<0.0001); and on average 20-fold higher in TEM than TN cells (N = 4, p<0.0001). Consistent with its repressive function for HIV, NRON also had higher expression in TCM and TEM compared to TN cells (Figs 3 and S3) (average 1.7-fold higher in TCM than TN cells (N = 6, p = 0.002); average 4.1-fold higher in TEM than TN cells (N = 3, p<0.001)). Because PVT1 and RP11-347C18.3 were up-regulated in latency and in memory cells, their predicted function would be repression of HIV expression. In contrast, because RP11-539L10.2 was down-regulated in latency and had higher expression in memory cells, it would be predicted to promote HIV expression.
Fig. 3. Comparison of lncRNA expression in TN and TCM T-cells. Expression of PVT1, RP11-347C18.3, RP11-539L10.2 and NRON was measured by ddPCR and normalized to expression of the housekeeping gene RPL27. Six independent experiments were performed using uninfected CD4+ T-cells. Significance was determined using a paired two-sided t-test for log2 transformed data. Data is presented as individual data points (copy numbers normalized to RPL27) symbol-coded by donor, mean of all values is shown. Samples were generated using blood from donors who were different from those who participated in the study that used models of HIV latency. TN, naïve CD4+ T-cells; TCM, central memory CD4+ T-cells. Identification of cellular pathways associated with lncRNAs dysregulated in the models of HIV latency
We further inferred function of dysregulated lncRNAs in HIV latency using GBA analysis, which determines correlations between lncRNA and mRNA expression in combination with enrichment strategies to identify cellular pathways associated with lncRNAs. Among the identified pathways, some were found in association with dysregulated lncRNA for both the cultured TCM and the bystander models (S4 and S5 Figs). Specifically, Spliceosome, Ribosome, Proteasome, and Protein export pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG), and Proteasome pathway from Biocarta database were associated with multiple dysregulated lncRNAs in both models (Fig 4). Of these, proteasome function has been previously implicated in maintaining HIV in latent state, and proteasome inhibitors were proposed as LRAs [30, 31]. Among other pathways with proposed roles in HIV latent reservoir establishment or maintenance, were p53 signaling [21] and mammalian target of rapamycin (MTOR) [32]. KEGG p53 signaling pathway had many lncRNA associations in both models, while lncRNA associations with Biocarta p53 pathway was only found for the bystander model (Fig 4). Fewer lncRNAs were associated to Biocarta MTOR, but for both models of HIV latency (Fig 4). Proper splicing is important for HIV protein production toward viral replication, but also toward antigen presentation to the immune system for killing of infected cells. Therefore, we and others propose that regulation of the spliceosome can critically regulate viral latency through multiple mechanisms [33, 34]. Through down-regulation of singly-spliced and unspliced messages, the virus can remain in a non-replicative state while being invisible to the immune system. Favoring certain doubly-spliced messages, specifically those encoded by Nef, the virus can also down-regulate molecules required for antigen presentation by the infected cell. Thus, it is plausible to hypothesize that spliceosome pathway may also have relevance to regulation of HIV latency. In addition, splicing factors that contain serine/arginine (SR) domains are well known regulators of HIV splicing [35]. Dysregulated lncRNA were found in association with several genes that encode SR protein mRNAs: SRSF2, SRSF3, SRSF6, SRSF7 and SRSF10.
Fig. 4. Pathways associated with lncRNA dysregulated in latency, identified by the guilt-by-association (GBA) analysis. Expression of lncRNAs dysregulated in latency (EdgeR’s FDR corrected p-value<0.05) was correlated with expression of all detected mRNAs. A ranked mRNA gene list was constructed for each lncRNA based on their correlation coefficients and used as input for gene set enrichment analysis (GSEA) with KEGG and Biocarta pathway databases. A lncRNA was considered significantly associated to a pathway when the GSEA FDR corrected p-value was less than 0.05. Number of lncRNA pathway associations is shown on the X-axis for the bystander model and Y-axis for cultured TCM model, color-coded with blue shades and indicated by the size of the circle (lighter blue color and larger circle size correspond to the greater number of associations). Ribosome and spliceosome pathways have the most associations with dysregulated lncRNAs in both models. Pathways that line up along the X axis were identified for the bystander model dataset only; while pathways that line up along the Y axis were identified for the cultured TCM model only. Pathways relevant to HIV latency are highlighted by red boxes. Next, we explored the associations between lncRNA expression and expression of individual members (mRNAs) of pathways implicated in HIV latency. Expression of the individual genes of the KEGG p53 signaling pathway positively correlated with expression of dysregulated lncRNAs, while Biocarta MTOR showed mostly negative associations (Fig 5). Both KEGG and Biocarta proteasome pathway exhibited mostly negative associations (Fig 5). Many mRNAs with highest number of associations to dysregulated lncRNAs were shared for both proteasome and MTOR pathways. In contrast, p53 pathway had a cluster of mRNAs commonly associated with dysregulated lncRNAs for both the cultured TCM and the bystander models (e.g. top right on the top panel in Fig 5), while other mRNAs were model-specific (e.g. a cluster of genes specific for the bystander model of HIV latency at the bottom right on the top panel in Fig 5). Overall, these data are consistent with a possibility that these pathways are regulated via multiple lncRNAs, and that control by lncRNA has both shared and unique components of the same pathway.
Fig. 5. Associations between dysregulated lncRNAs and the mRNA components of pathways implicated in HIV latency. PVT1 and RP11-347C18.3 are associated with pathways implicated in regulation of HIV latency
We further focused our attention on lncRNAs that were dysregulated in both models of latency and validated by ddPCR, namely PVT1, RP11-347C18.3 and RP11-539L10.2. We aimed to determine whether these lncRNAs were specifically associated with pathways implicated in regulation of HIV expression. Of these, PVT1 exhibited the most associations (Fig 6), including both KEGG and Biocarta p53 signaling pathway, Biocarta MTOR and proteasome pathways, and KEGG spliceosome pathway. Most of these associations were found for the bystander model and not the cultured TCM model; however, spliceosome, and a number of SR splicing factors in particular associated with PVT1 for both models (Fig 6). RP11-347C18.3 was associated with p53 signaling, both for KEGG and Biocarta pathways, and with the KEGG spliceosome pathway (S2 Table). RP11-539L10.2 was not associated with any annotated pathways implicated in HIV latency (S2 Table). The role of RP11-539L10.2 lncRNAs in regulation of HIV latency cannot be excluded based on these results, because it may function via control of a single critical host gene or its protein product, by directly targeting HIV, or via a pathway that is not annotated in the KEGG or Biocarta database. However, roles for PVT1 and RP11-347C18.3 are more likely based on identification of multiple HIV latency-related pathways associated with these lncRNAs.
Fig. 6. Associations between PVT1 and mRNA components of identified associated KEGG and Biocarta pathways. Output of the guilt-by-association analysis was filtered for PVT1-specific pathway associations and corresponding leading edge mRNAs (GSEA FDR < 0.05). Next, a matrix with PVT1-specific information on pathway association, HIV latency model, enrichment score and leading edge mRNAs served as input for Cytoscape visualization (v3.4.0). Associations between PVT1 and mRNAs in all pathways (FDR corrected p<0.05) are shown. Nodes represent individual mRNAs associated with PVT1 and are color coded by model of HIV latency: blue, cultured TCM model, green, bystander model, and yellow, common association for both models. Nodes in a shape of a rhombus indicate mRNAs involved in HIV replication (annotated in the NCBI HIV-1 Interaction Database, HIVintDb). The color of the lines connecting PVT1 to mRNAs indicate correlation (red, positive; blue, negative). Names of pathways implicated in HIV latency are indicated in red. Treatment with SAHA and RMD results in down-regulation of lncRNAs dysregulated in the models of HIV latency
Finally, we have assessed how treatment with clinically tested LRAs, histone deacetylase inhibitors (HDACi) SAHA and RMD, affects expression of dysregulated lncRNAs. Samples from four to six replicates from the bystander model were used for this experiment. PVT1 and NRON were down-regulated by SAHA and RMD in the bystander model and mock-infected cells (PVT1: SAHA mock average fold-change -1.78, RMD mock average fold change -3.48, SAHA model of latency average fold change -2.1, RMD model of latency average fold change -2.8, p<0.0001; NRON: SAHA mock average fold-change -1.9, RMD mock average fold change -2.8, SAHA model of latency average fold change -3.5, RMD model of latency average fold change -2.8, p<0.001) (Fig 7). RP11-347C18.3 was down-regulated in all conditions except by SAHA in mock-infected cells (RMD mock average fold change -2.0, p = 0.004; SAHA model of latency average fold change -1.56, RMD model of latency average fold change -2.7, p<0.0001) (Fig 7). RP11-539L10.2 was down-regulated in all conditions except by RMD in the bystander model of HIV latency (SAHA mock average fold-change -3.81, RMD mock average fold change -3.43, p<0.0001; SAHA model of latency average fold change -2.25, p = 0.002) (S6 Fig). Overall, these results demonstrate that the effects of SAHA and RMD on expression of selected lncRNAs appear to be independent from HIV infection. As the primary mechanism of action of HDACi is chromatin decondensation leading to induction of gene transcription, down-regulation of the tested lncRNAs most likely represents a secondary mechanism of action of these compounds.
Fig. 7. Down-regulation of PVT1, RP11-347C18.3 and NRON by SAHA and RMD. Mock-infected cells and the bystander model of HIV latency were treated with SAHA (1 μM), RMD (15 nM) or their solvent DMSO for 24 hours. Expression of lncRNAs was measured by ddPCR and normalized to expression of the housekeeping gene RPL27. Six replicate experiments were performed. Significance was determined by implementing repeated measures analysis of variance (RM ANOVA) with library nlme in R using log2 transformed data. Data is presented as individual data points (copy numbers normalized to RPL27) symbol-coded by donor, mean of all values is shown. DMSO, dimethyl sulfoxide; SAHA, suberoylanilide hydroxamic acid; RMD, Romidepsin; ns, not significant (p-value > 0.05). Discussion
The present study aimed to prioritize lncRNAs to be tested as targets for HIV latency reversal. We used several complementary approaches, including the identification of dysregulated lncRNAs in primary T-cell models of HIV latency (Figs 2 and S1 and S2and Tables 1, 2 and S1), GBA analysis (Figs 4–6 and S4 and S5 and S2 Table), evaluation of lncRNA expression in major CD4+ T-cell maturation subsets (Figs 3 and S3) and in CD4+ T-cells treated with clinically tested LRAs (Figs 7 and S6.
Among lncRNAs dysregulated in the models of HIV latency, 10 were in common between the two models (Table 2). In addition, 105 unique lncRNAs were identified for the cultured TCM model, and 137 for the bystander model (S1 Fig). Same protocols were followed to generate and analyze RNA-Seq data for both models (please refer to Materials and Methods); thus, discrepancies in the result caused by differences in experimental and analytical procedures are expected to be minimal. Therefore, it is likely that the observed differences in the identified dysregulated lncRNAs were due to biological differences of the two models. Specifically, T-cell composition and route of latency establishment may contribute to differential dysregulation of lncRNAs in latency. One observation in favor of this conclusion is that NRON was strongly up-regulated in the cultured TCM model that establishes latency in activated cells returning to quiescence, but not in the bystander model that uses direct infection of resting cells (S2 Fig). A prior study that demonstrated the role of NRON in latency maintenance [8] used a model with a similar route for latency establishment as our cultured TCM model.
We further focused our evaluation of possible functions of the four lncRNAs that were dysregulated in both models of latency and had higher expression levels among the ten lncRNA identified, namely PVT1, RP347C18.3, RP539L10.2 and NEAT1. Of these, NEAT1 differential expression was not validated by ddPCR in either model (S2 Fig). The prior studies demonstrating the role of NEAT1 in HIV RNA nuclear retention during productive HIV replication was performed using cell lines [6, 7]. Therefore, it is possible that NEAT1 may not function in the same manner in latently infected primary CD4+ T-cells. Because the effect size with the number of samples (N = 4) available in our RNA-Seq experiment was ≈1.5, and the observed difference for NEAT1 was smaller (1.41-fold in the cultured TCM model and 1.3-fold in the bystander model, Table 2), NEAT1 might represent one of the false positives detected in our RNA-Seq study. The remaining three selected lncRNAs were confirmed by ddPCR and evaluated in CD4+ T-cells of naïve and memory phenotypes. All of them exhibited higher expression in TCM and TEM cells (Figs 3 and S3), which represent the major component of the latent reservoir. PRDM1, a known HIV repressor whose function was evaluated in primary CD4+ T-cells, exhibited a similar pattern of expression in TN and TCM subsets [29]. LncRNA NRON, whose repressive function for HIV expression was previously demonstrated in primary CD4+ T-cells [8], also had higher expression in TCM and TEM compared to TN cells (Figs 3 and S3). Therefore, our observation of elevated expression of selected lncRNAs in memory cells is consistent with their possible function in regulation of HIV expression in latency.
GBA analysis was used to hone into potential functions of dysregulated lncRNAs in HIV latency control by determining whether they are associated to known pathways implicated in establishment or maintenance of HIV latency. GBA analysis identified proteasome, spliceosome, p53 signaling and MTOR among pathways associated with dysregulated lncRNAs (Figs 4 and S4 and S5). Most of the lncRNAs had negative associations with mRNA members of these pathways (Fig 5), consistent with a possibility of inhibitory regulation of gene expression of these pathways by lncRNA. Some of the mechanisms by which this regulation may occur include transcriptional interference, promoter inactivation by binding transcription factors, cytoplasmic retention of transcription factors, and epigenetic silencing [13, 36]. In contrast, the majority of associations in the p53 signaling pathway were positive (Fig 5). Such positive regulation may as well occur through chromatin remodeling and interactions with and recruitment of transcriptional activators [13]. In addition, lncRNAs may function by increasing stability of the mRNAs [37]. Negative [38] as well as positive [39] feedback loops have been reported between lncRNAs and proteins; however, independent studies of interactions between the identified lncRNAs and the members of associated pathways at the protein level would be required to determine whether this may be the case for regulation of HIV latency.
Of the three dysregulated lncRNAs that were validated by ddPCR, PVT1 was found in association with multiple pathways implicated in control of HIV latency (Fig 6). The common pathway identified for the cultured TCM and the bystander models associated with PVT1 was spliceosome (Fig 6). Remarkably, PVT1 was associated with a number of mRNAs encoding SR proteins, in common between the two models (Fig 6). Of these, SRSF2, SRSF6, and SRSF10 have been specifically linked to HIV splicing [40–43]. PVT1 was associated with members of p53 signaling, MTOR and proteasome pathway in the case of the bystander model only (Fig 6), consistent with the idea that pathways that regulate latency may be, at least in part, dependent on the model. PVT1 was found in association with p53 signaling pathway for both KEGG and Biocarta databases (Fig 6). The role of p53 signaling in HIV establishment and maintenance was demonstrated previously [21]. One protein member of this pathway, MDM2 Proto Oncogene (MDM2), was stabilized by PVT1 via its interaction with Enhancer Of Zeste 2 Polycomb Repressive Complex 2 Subunit (EZH2) in the setting of hepatocellular carcinoma [44]. Though the precise mechanism of regulation of p53 signaling pathway by PVT1 in different cell types needs further investigation, the positive regulation of it components was consistent in our study and the study by Guo and colleagues [44]. In addition, EZH2 itself contributes to regulation of HIV latency [45]. PVT1 interacted with and stabilized the EZH2 protein product [44], which could represent a potential mechanism of latency control by PVT1. In addition, PVT1 was shown to act as a sponge for multiple miRNAs [46–51], suggesting the possibility for positive regulation of multiple mRNAs in the p53 signaling pathway that represent miRNA targets. Based on these results, we speculate that PVT1 may function in HIV latency control via modulating mRNA components of p53 signaling pathway and splicing machinery.
Intriguingly, identified associations of PVT1 to cellular pathways demonstrate possible links between inferred mechanisms of regulation of gene expression by PVT1 in HIV latency and other diseases, such as basal cell carcinoma and systemic lupus erythematosus (Fig 6). We speculate that a subset of dysregulated genes that may be regulated by PVT1 is shared between these conditions. For example, TCF7L2 (also known as TCF-4) from the basal cell carcinoma pathway plays a role in HIV latency maintenance [52] and was up-regulated in the bystander model in our study (S1 Table). For the systemic lupus erythematosus pathway, the majority of genes linked to PVT1 are histone-coding genes. Epigenetic alterations, histone modifications in particular, largely contribute to gene expression dysregulation in systemic lupus erythematosus [53]. A number of histone-coding genes were dysregulated at the RNA level in systemic lupus erythematosus [54] and the cultured TCM model in our study (S1 Table).
Lastly, our study investigated the effects of clinically tested LRAs, SAHA and RMD, on expression of lncRNAs dysregulated in latency, PVT1, RP11-347C18.3, RP11-539L10.2, and NRON. SAHA and RMD are HDACi, whose primary mechanism of action is histone hyperacetylation which results in chromatin decondensation and elevated gene expression. However, multiple studies demonstrated that HDACi cause gene down-regulation [55–57], which likely represents secondary mechanisms of action of these compounds. Our prior investigation of these secondary effects on protein coding genes suggested presence of both stimulatory and inhibitory effects of HDACi with respect to HIV reactivation [19, 58]. All tested lncRNAs, PVT1, RP11-347C18.3, RP11-539L10.2, and NRON were down-regulated by SAHA and RMD, independent of the presence of latent infection (Figs 7 and S6). When HIV is present, down-regulation of PVT1, RP11-347C18.3, and NRON, which were up-regulated in latency, may represent stimulatory effects. Further down-regulation of RP11-539L10.2 by SAHA, beyond levels of down-regulation observed in latency compared to mock-infected cells, may represent an inhibitory effect. Thus, both stimulatory and inhibitory effects of HDACi are likely present among non-coding genes. The results from this study provide basis for hypothesis building to identify candidate lncRNAs whose experimental down-regulation (such as via knockdowns) may be synergistic with HDACi treatment for latency reversal.
One limitation of the present study is the low frequency of latently infected cells in a large background of uninfected cells for both models of HIV latency (range 8.8% to 44.3% [19, 21]). This is a common problem for models that use replication-competent wild type HIV virus. Therefore, we conducted a comparison of dysregulated lncRNAs in two different well characterized models [16–19, 21, 59] to attempt to overcome the limitation introduced by high background of uninfected cells. Only lncRNAs found dysregulated in both models were analyzed in more detail. Characterization of single cell transcriptomes using the cultured TCM and bystander models might be beneficial for identification of a greater number of overlapping lncRNAs and for validating the role of T-cell maturation state and prior activation in lncRNA expression signatures of latently infected cells.
The second limitation is a possibility that differential gene expression may result from the exposure of cells to cytokines and chemokines produced by cells during productive infection, or due to exposure to the virus in culture. To control for cytokine and chemokine exposure during T-cell activation, we ensured that the mock-infected cells were treated the same way as infected cells throughout the culture. We have also searched for interferon stimulated genes with known antiviral properties [22] and DNA sensors [23] among genes that were differentially expressed in the latency models compared to mock-infected cells. Some such responses were detected, predominantly in the cultured TCM model. It is also possible that transcriptional profiles could be influenced by virus via interferon-independent cascades [60, 61]. While a good control for these effects might be the use of anti-virals during the stages of latency establishment, or the use of cells exposed to the aldrithiol-2 inactivated virus [62] instead of mock-infected cells, we were limited by analyzing previously published RNA-Seq datasets that did not include these controls. Nonetheless, identification of a subset of genes with known roles in HIV latency supports the potential of this experimental and analytical approach to identify genes specifically affected during HIV latency and not purely by cytokines or exposure to virus. Indeed, expression of p21 (gene symbol CDKN1A) was elevated in the cell line model of latency [63] and in the bystander model in the present study (S1 Table). Its expression negatively correlated with cell-associated HIV RNA and HIV transcriptional activity in HIV-infected virologically suppressed individuals on cART [64], and its protein product inhibited transcription from the integrated provirus via inhibition of Cyclin Dependent Kinase 9 (CDK9), a component of positive transcription elongation factor (P-TEFb) [65]. Another example is PRDM1, up-regulated in both models in the present study (S1 Table), which was previously shown to be a repressor of basal and Tat-dependent HIV transcription [29]. Moreover, expression of the only lncRNA with demonstrated role in HIV repression in primary CD4+ T-cells, NRON [8], was also up-regulated in the cultured TCM model in the present study (S2 Fig). These observations are consistent with the idea that at least a subset of genes and lncRNAs found dysregulated in latency in the present study has demonstrated roles as HIV regulators. Ultimately, identified lncRNAs will need to be validated as HIV regulators using functional studies (e.g. experimental gene expression knockdowns) using relevant model systems and cells from HIV-infected individuals ex vivo.
In summary, the present study used gene expression profiling by RNA-Seq in two primary T-cell models of HIV latency to focus on identification of dysregulated lncRNAs. Despite differences in cell composition and route of latency establishment between the models, common lncRNA signatures associated with latency could be identified. LncRNAs dysregulated in latency had higher expression in memory cells that represent the major HIV reservoir, as compared to TN cells. We further identified pathways associated with dysregulated lncRNA, including pathways previously implicated in HIV latency: proteasome, spliceosome, p53 signaling and MTOR. Of the lncRNAs that were dysregulated in common between the two models, PVT1 had the most associations to these pathways. We have proposed several mechanisms of action for PVT1 to regulate HIV latency, based on evidence for PVT1 function from published literature. Identification of model-specific dysregulated lncRNAs and lncRNA-associated pathways will facilitate better understanding of the mechanisms by which latency is established and maintained in different cell types. The role of the identified lncRNAs in HIV latency and their mechanisms of action warrant further experimental exploration to determine their suitability as targets for antiviral strategies. Our study facilitates prioritization of lncRNAs to be tested in this setting.
Materials and methods
Study participants
Primary CD4+ T-cells from HIV seronegative volunteer blood donors were used for this study. The protocol was approved by the Institutional Review Boards of the University of California San Diego, and the VA San Diego Healthcare System and abides by the Declaration of Helsinki principles. All volunteers gave written informed consent to participate in the study.
In vitro models of HIV latency
To identify lncRNAs dysregulated in HIV latency, two primary T-cell models were used [16–18]. In the cultured TCM model, TN cells are activated and polarized to direct differentiation into TCM cells, which are phenotypically very similar to TCM cells freshly isolated from blood [17]. Latency is established in the presence of IL-2 and cART in cultured TCM cells that are gradually returning to quiescence and becoming resting; positive magnetic isolation of CD4+ T cells is used to sort out cells that remain productively infected [16, 59]. In the bystander model developed by Dr. Celsa Spina [18, 19], latency is established directly in resting CD4+ T-cells, represented by all maturation phenotypes found in vivo. Both the cultured TCM and the bystander models utilized wild type HIVNL4.3 virus. Expression of p24/Gag protein during model-set up was assessed as described previously, using ICp24 antibody conjugated to fluorescein isothiocyanate (FITC) (clone KC57, Coulter) for cultured TCM model [16]; for bystander model, ICp24 antibody conjugated to phycoerythrin (PE) (clone KC57, Coulter) was used. To establish a mock-infected control, a portion of cells was cultured under the same conditions in parallel, but without exposure to the virus.
Identification of lncRNAs dysregulated in HIV latency
For the cultured TCM model, we used a previously published dataset [21] (raw and processed data available at Gene Expression Omnibus (GEO) database, accession number https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE81810) to re-analyze focusing on dysregulated lncRNAs. For the bystander model, we used RNA-Seq data available at GEO under accession number GSE114883. This dataset includes samples for mock-infected cells and latency model treated with HDACi SAHA and RMD and their solvent dimethyl sulfoxide (DMSO). DMSO-treated samples from this dataset were used to perform differential gene expression analysis between mock-infected cells and cells from the model of HIV latency. To minimize variation due to analytical procedures, bystander model data was analyzed in the same manner as previously published TCM model dataset [21]. Briefly, Tophat [66] was used for mapping to human genome version hg38 and HTSeq [67] for read counting against the Gencode gene annotation version 21. Mapping to HIV and synthetic RNA standards from the External RNA Controls Consortium (ERCC) was performed using Bowtie [68]. Differential expression analysis was performed using library EdgeR [69] in Bioconductor R and normalization to ERCC spike-ins with RUVSeq [70]. Genes and lncRNAs with false discovery rate (FDR) corrected p-values less than 0.05 were considered differentially expressed.
Among total differentially expressed genes in both models, lncRNAs and their types (intergenic, intronic, etc.) were determined using Gencode gene annotation version 21 with Ensembl IDs as unique identifiers. Visualization of differential expression included volcano plots and heatmaps that were constructed via in-house bioinformatics scripts and based on the package gplots (v3.0.1) in the R computing environment [71]. Enrichment of lncRNA types in the lists of dysregulated lncRNAs was evaluated via comparison of ratios with the lncRNA type distribution of the total pool of lncRNAs in the Gencode database (Fisher’s exact test).
Isolation of TN, TCM, and TEM CD4+ T-cell subsets
All antibodies were obtained from BD Biosciences, Inc. (San Jose, CA, USA). Antibodies for cell quality control were αCD4 (multiclone SK3 SK4) conjugated to FITC, and αHLA-DR (clone L243) conjugated to PE. Antibodies for isolation of CD4+ T-cell maturation subsets were αCD45RA (clone L48) conjugated to phycoerythrin-cyanine dye (PE-Cy7), and αCD62L (clone DREG-56) conjugated to allophycocyanin (APC). CD4+ T-cells were isolated from whole blood using negative selection (StemCell Technologies, Inc., Vancouver, Canada). All CD4+ T-cell samples had >95% purity and <10% expression of activation marker HLA-DR, as assessed using the Accuri C6 flow cytometer (BD Biosciences, Inc., San Jose, CA, USA). To isolate T-cell maturation subsets, CD4+ T-cells were stained with αCD45RA and αCD62L antibodies, and sorted on a MoFlo XDP Cell Sorter (Beckman Coulter, Brea, CA, USA) to obtain TN (CD45RA+CD62L+), TCM (CD45RA-CD62L+) and TEM (CD45RA-CD62L-) cell populations.
Treatment with SAHA and RMD
Aliquots of SAHA and RMD solubilized in DMSO were provided by Merck Research Laboratories, Inc. (Kenilworth, NJ, USA), and Gilead Sciences, Inc. (Foster City, CA, USA), respectively. Mock-infected cells and the bystander model of HIV latency were treated with 1 μM SAHA, 15 nM RMD or their solvent DMSO for 24 hours.
Isolation of RNA
RNA was isolated from CD4+ T-cells using RNeasy micro kit (Qiagen, Inc., Valencia, CA). RNA concentrations were assessed using Qubit 2.0 fluorometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA).
Droplet digital PCR (ddPCR)
Four lncRNA dysregulated in both models of latency were selected for confirmation by ddPCR. The selection was made based on expression level likely detectable in a single ddPCR reaction (number of reads per base in the RNA-Seq experiment >0.1). Reads per base were calculated by dividing the number of reads mapped to each lncRNA by the average transcript length as determined by GenomicFeatures library [72] in Bioconductor R. The assays to measure lncRNA expression were custom designed and purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA). The assays were as follows: NEAT1 both short and long isoforms (N1+N2): forward 5’ TTCATGGACCGTGGTTTG 3’, reverse 5’ 56-FAM/CTGCAATGCTAGGACTCAC 3’, probe 5’ TTCCTCATG/ZEN/GCGAGCAGATGGAAC/3IABkFQ 3’; NEAT1 long isoform (N2): 5’ forward ACGTGTTGCATGGTTTCT 3’, reverse: 5’ ATGAGGGCAGTTCTCTGT 3’, probe 5’ 56-FAM/AACAGTAGG/ZEN/GAGATGCCTGGGAGTA/3IABkFQ 3’; PVT1: forward 5’ GAGGGTTGAGATCTCTGTTTAC 3’, reverse 5’ GATGCTTCACCAGGAAGAG 3’, probe 5’ 56-FAM/TCTGCCAAC/ZEN/TTCCTTTGGGTCTCC/3IABkFQ 3’; RP11-347C18.3: forward 5’ AGCTCTCATGTGACCCA 3’, reverse 5’ AATAACCTGGTGAGTTGGC 3’, probe 5’ 56-FAM/ACCTGCAAA/ZEN/TTGTGGGCATTCACG/3IABkFQ 3’; RP11-539L10.2: forward 5’ TTTGGTCCCTGGCTTTG 3’, reverse 5’ CCCTATCTCTGATCATTGTCAC 3’, probe 5’ 56-FAM/TTGTGACCC/ZEN/GAGTGTCAGTTTCCT/3IABkFQ/ 3’. NRON lncRNA, which was not annotated in the RNA-Seq datasets, was measured by ddPCR using assay Hs04274937_s1 from Applied Biosystems (now Thermo Fisher Scientific, Inc., Waltham, MA, USA). Housekeeping gene Ribosomal Protein L27 (RPL27) was used as a normalizer [55, 58, 73]. The assay (HS03044961_g1) to measure RPL27 was purchased from Applied Biosystems (now Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNA was converted to cDNA using qScript (Quanta Bio, Beverly, MA). Concentration of RNA in all cDNA reactions was 1 ng/μl, except for lowly expressed NRON, for which 10 ng/μl was used. DdPCR reactions were set up and run as described previously [58]. LncRNAs whose dysregulation in latency were confirmed (PVT1, RP11-347C18.3, RP11-539L10.2 and NRON) were further measured in CD4+ T-cell maturation subsets and in CD4+ T-cells following treatment with SAHA and RMD.
GBA analysis
The GBA analysis to associate lncRNAs with biological pathways was performed as described previously [14, 74]. Briefly, the GBA pipeline first builds a Spearman’s rank correlation matrix between the differentially expressed lncRNAs and all expressed mRNAs based on the normalized gene expression values of the samples (counts per million). Next, a ranked mRNA gene list was constructed for each lncRNA based on their correlation coefficients and used as input for gene set enrichment analysis (GSEA) [75] together with pathways from the Biocarta [76] and KEGG [77] databases. A lncRNA was considered significantly associated to a pathway when the GSEA FDR corrected p-value was less than 0.05. The GBA was implemented separately for the primary models of HIV latency and results were compared and overlapped afterwards. Visualization of significant pathway - and mRNA-associations was performed with in-house R scripts based on the ggplot2 package (v2.2.1). Visualization of individual lncRNA associations was performed using Cytoscape v3.4.0 [78].
Statistical analyses
All statistical analyses were performed in the R computing environment [71]. Effect size in the RNA-Seq experiment was determined using library RNASeqPower [79]. DdPCR data was expressed as copies of each lncRNA per one thousand copies of RPL27. Because of lower expression of NRON, this lncRNA was expressed as copies per hundred thousand copies of RPL27. These normalized copies were log2 transformed. The equal variance test was performed using function var.test. Based on these results, paired t-tests (function t.test) with equal or unequal variance were used for two-group comparisons. For ddPCR validation experiments, we had prior knowledge about the direction of change of expression in models of latency as compared to mock-infected cells; therefore, one-sided tests were performed. For two-group comparisons without prior knowledge of the direction of change, two-sided tests were conducted. Repeated measures analysis of variance (RM ANOVA) was implemented for multi-group comparisons using library nlme [80] followed by post-hoc Tukey test. For each model, residuals were measured and tested for normality using the shapiro.test in R. Examination of the distribution of residuals and ggplots indicated that there were no large deviations from normality; therefore the requirements of the t-test and ANOVA were satisfied. All graphs were constructed using GraphPad Prism software (GraphPad Software, La Jolla, CA, USA). If RNA from the same donor was used for multiple measurements, the symbol for that donor is consistently shaped and colored throughout.
Supporting information
S1 Fig [pdf]
Comparison of dysregulated protein coding genes and lncRNAs in the cultured T and the bystander latency models.S2 Fig [short]
Validation of lncRNA dysregulation in latency by ddPCR.S3 Fig [pdf]
Comparison of lncRNA expression in T, T, and T T-cells.S4 Fig [pdf]
Unique and common KEGG pathways associated with lncRNA dysregulated in latency for the cultured T and the bystander models, identified by the guilt-by-association (GBA) analysis.S5 Fig [pdf]
Unique and common Biocarta pathways associated with lncRNA dysregulated in latency for the cultured TCM and the bystander models, identified by the guilt-by-association (GBA) analysis.S6 Fig [pdf]
Down-regulation of . by SAHA and RMD.S1 Table [xlsx]
Genes and lncRNAs dysregulated in latency.S2 Table [xlsx]
Cellular pathways associated with lncRNAs . and ..
Zdroje
1. Richman DD, Margolis DM, Delaney M, Greene WC, Hazuda DJ, Pomerantz RJ. The challenge of finding a cure for HIV infection. Science. 2009;323(5919):1304–7. doi: 10.1126/science.1165706 19265012
2. Ho YC, Shan L, Hosmane NN, Wang J, Laskey SB, Rosenbloom DI, et al. Replication-competent noninduced proviruses in the latent reservoir increase barrier to HIV-1 cure. Cell. 2013;155(3):540–51. doi: 10.1016/j.cell.2013.09.020 24243014
3. Castro-Gonzalez S, Colomer-Lluch M, Serra-Moreno R. Barriers for HIV cure: the latent reservoir. AIDS Res Hum Retroviruses. 2018;34(9):739–59. doi: 10.1089/AID.2018.0118 30056745
4. Rasmussen TA, Lewin SR. Shocking HIV out of hiding: where are we with clinical trials of latency reversing agents? Curr Opin HIV AIDS. 2016;11(4):394–401. doi: 10.1097/COH.0000000000000279 26974532
5. Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res. 2012;22(9):1775–89. doi: 10.1101/gr.132159.111 22955988
6. Zhang Q, Chen C-Y, Yedavalli VS, Jeang K-T. NEAT1 long noncoding RNA and paraspeckle bodies modulate HIV-1 posttranscriptional expression. mBio. 2013;4(1):e00596–12. doi: 10.1128/mBio.00596-12 23362321
7. Liu H, Hu P-W, Couturier J, Lewis DE, Rice AP. HIV-1 replication in CD4+ T cells exploits the down-regulation of antiviral NEAT1 long non-coding RNAs following T cell activation. Virology. 2018;522 : 193–8. https://doi.org/10.1016/j.virol.2018.07.020 30036787
8. Li J, Chen C, Ma X, Geng G, Liu B, Zhang Y, et al. Long noncoding RNA NRON contributes to HIV-1 latency by specifically inducing tat protein degradation. Nat Commun. 2016;7 : 11730. doi: 10.1038/ncomms11730 27291871
9. Imam H, Shahr Bano A, Patel P, Holla P, Jameel S. The lncRNA NRON modulates HIV-1 replication in a NFAT-dependent manner and is differentially regulated by early and late viral proteins. Sci Rep. 2015;5 : 8639. doi: 10.1038/srep08639 25728138
10. Cron RQ, Bartz SR, Clausell A, Bort SJ, Klebanoff SJ, Lewis DB. NFAT1 enhances HIV-1 gene expression in primary human CD4 T cells. Clin Immunol. 2000;94(3):179–91. doi: 10.1006/clim.1999.4831 10692237
11. Huan C, Li Z, Ning S, Wang H, Yu X-F, Zhang W. Long noncoding RNA uc002yug.2 activates HIV-1 latency through regulation of mRNA levels of various RUNX1 isoforms and increased Tat expression. J Virol. 2018;92(9). doi: 10.1128/jvi.01844-17 29491162
12. Ma L, Sun L, Jin X, Qu D, Sun W-W, Wang J-H, et al. Long noncoding RNA MALAT1 releases epigenetic silencing of HIV-1 replication by displacing the polycomb repressive complex 2 from binding to the LTR promoter. Nucleic Acids Res. 2019;47(6):3013–3027. doi: 10.1093/nar/gkz117 30788509
13. Ponting CP, Oliver PL, Reik W. Evolution and functions of long noncoding RNAs. Cell. 2009;136(4):629–41. doi: 10.1016/j.cell.2009.02.006 19239885
14. Trypsteen W, Mohammadi P, Van Hecke C, Mestdagh P, Lefever S, Saeys Y, et al. Differential expression of lncRNAs during the HIV replication cycle: an underestimated layer in the HIV-host interplay. Sci Rep. 2016;6 : 36111. doi: 10.1038/srep36111 27782208
15. Peng X, Sova P, Green RR, Thomas MJ, Korth MJ, Proll S, et al. Deep sequencing of HIV-infected cells: insights into nascent transcription and host-directed therapy. J Virol. 2014;88(16):8768–82. doi: 10.1128/JVI.00768-14 24850744
16. Martins LJ, Bonczkowski P, Spivak AM, De Spiegelaere W, Novis CL, DePaula-Silva AB, et al. Modeling HIV-1 latency in primary T cells using a replication-competent virus. AIDS Res Hum Retroviruses. 2016;32(2):187–93. doi: 10.1089/aid.2015.0106 26171776
17. Bosque A, Planelles V. Induction of HIV-1 latency and reactivation in primary memory CD4+ T cells. Blood. 2009;113(1):58–65. doi: 10.1182/blood-2008-07-168393 18849485
18. Spina CA, Anderson J, Archin NM, Bosque A, Chan J, Famiglietti M, et al. An in-depth comparison of latent HIV-1 reactivation in multiple cell model systems and resting CD4+ T cells from aviremic patients. PLoS Pathog. 2013;9(12). doi: 10.1371/journal.ppat.1003834 24385908
19. Beliakova-Bethell N, Mukim A, White CH, Deshmukh S, Abewe H, Richman DD, et al. Histone deacetylase inhibitors induce complex host responses that contribute to differential potencies of these compounds in HIV reactivation. J Biol Chem. 2019;294(14):5576–89. doi: 10.1074/jbc.RA118.005185 30745362
20. Bosque A, Famiglietti M, Weyrich AS, Goulston C, Planelles V. Homeostatic proliferation fails to efficiently reactivate HIV-1 latently infected central memory CD4+ T cells. PLoS Pathog. 2011;7(10):e1002288. doi: 10.1371/journal.ppat.1002288 21998586
21. White CH, Moesker B, Beliakova-Bethell N, Martins LJ, Spina CA, Margolis DM, et al. Transcriptomic analysis implicates the p53 signaling pathway in the establishment of HIV-1 latency in central memory CD4 T cells in an In vitro model. PLoS Pathog. 2016;12(11):e1006026. doi: 10.1371/journal.ppat.1006026 27898737
22. Schoggins JW, Rice CM. Interferon-stimulated genes and their antiviral effector functions. Curr Opin Virol. 2011;1(6):519–25. doi: 10.1016/j.coviro.2011.10.008 22328912
23. Monroe KM, Yang Z, Johnson JR, Geng X, Doitsh G, Krogan NJ, et al. IFI16 DNA sensor is required for death of lymphoid CD4 T cells abortively infected with HIV. Science. 2014;343(6169):428–32. Epub 12/19. doi: 10.1126/science.1243640 24356113
24. Soriano-Sarabia N, Bateson RE, Dahl NP, Crooks AM, Kuruc JD, Margolis DM, et al. Quantitation of replication-competent HIV-1 in populations of resting CD4+ T cells. J Virol. 2014;88(24):14070–7. doi: 10.1128/JVI.01900-14 25253353
25. Chun T-W, Carruth L, Finzi D, Shen X, DiGiuseppe JA, Taylor H, et al. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature. 1997;387(6629):183–8. doi: 10.1038/387183a0 9144289
26. Siliciano JD, Kajdas J, Finzi D, Quinn TC, Chadwick K, Margolick JB, et al. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat Med. 2003;9(6):727–8. doi: 10.1038/nm880 12754504
27. Spina CA, Prince HE, Richman DD. Preferential replication of HIV-1 in the CD45RO memory cell subset of primary CD4 lymphocytes in vitro. J Clin Invest. 1997;99(7):1774–85. doi: 10.1172/JCI119342 9120023
28. Chomont N, El-Far M, Ancuta P, Trautmann L, Procopio FA, Yassine-Diab B, et al. HIV reservoir size and persistence are driven by T cell survival and homeostatic proliferation. Nat Med. 2009;15(8):893–900. doi: 10.1038/nm.1972 19543283
29. Kaczmarek Michaels K, Natarajan M, Euler Z, Alter G, Viglianti G, Henderson AJ. Blimp-1, an intrinsic factor that represses HIV-1 proviral transcription in memory CD4+ T cells. J Immunol. 2015;194(7):3267–74. doi: 10.4049/jimmunol.1402581 25710909
30. Miller LK, Kobayashi Y, Chen C-C, Russnak TA, Ron Y, Dougherty JP. Proteasome inhibitors act as bifunctional antagonists of human immunodeficiency virus type 1 latency and replication. Retrovirology. 2013;10 : 120. doi: 10.1186/1742-4690-10-120 24156270
31. Lin J, Zhang X, Lu W, Xu X, Pan X, Liang T, et al. PR-957, a selective immunoproteasome inhibitor, reactivates latent HIV-1 through p-TEFb activation mediated by HSF-1. Biochem Pharmacol. 2018. doi: 10.1016/j.bcp.2018.08.042 30170098
32. Besnard E, Hakre S, Kampmann M, Lim HW, Hosmane NN, Martin A, et al. The mTOR complex controls HIV latency. Cell Host Microbe. 2016;20(6):785–97. doi: 10.1016/j.chom.2016.11.001 27978436
33. Lassen KG, Ramyar KX, Bailey JR, Zhou Y, Siliciano RF. Nuclear retention of multiply spliced HIV-1 RNA in resting CD4+ T cells. PLoS Pathog. 2006;2:e68. doi: 10.1371/journal.ppat.0020068 16839202
34. Yukl SA, Kaiser P, Kim P, Telwatte S, Joshi SK, Vu M, et al. HIV latency in isolated patient CD4+ T cells may be due to blocks in HIV transcriptional elongation, completion, and splicing. Sci Transl Med. 2018;10(430). doi: 10.1126/scitranslmed.aap9927 29491188
35. Mahiet C, Swanson CM. Control of HIV-1 gene expression by SR proteins. Biochem Soc Trans. 2016;44(5):1417–25. doi: 10.1042/BST20160113 27911724
36. Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, et al. Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Nat Acad Sci U S A. 2009;106(28):11667–72. doi: 10.1073/pnas.0904715106 19571010
37. Zhang R, Ni F, Fu B, Wu Y, Sun R, Tian Z, et al. A long noncoding RNA positively regulates CD56 in human natural killer cells. Oncotarget. 2016;7(45):72546–58. doi: 10.18632/oncotarget.12466 27713137
38. Zhai N, Xia Y, Yin R, Liu J, Gao F. A negative regulation loop of long noncoding RNA HOTAIR and p53 in non-small-cell lung cancer. OncoTargets Ther. 2016;9 : 5713–20. doi: 10.2147/OTT.S110219 27695348
39. Xu M-d, Wang Y, Weng W, Wei P, Qi P, Zhang Q, et al. A positive feedback loop of lncRNA PVT1 and FOXM1 facilitates gastric cancer growth and invasion. Clin Cancer Res. 2017;23(8):2071–80. doi: 10.1158/1078-0432.CCR-16-0742 27756785
40. Erkelenz S, Hillebrand F, Widera M, Theiss S, Fayyaz A, Degrandi D, et al. Balanced splicing at the Tat-specific HIV-1 3'ss A3 is critical for HIV-1 replication. Retrovirology. 2015;12 : 29. doi: 10.1186/s12977-015-0154-8 25889056
41. Tranell A, Fenyö EM, Schwartz S. Serine - and arginine-rich proteins 55 and 75 (SRp55 and SRp75) induce production of HIV-1 vpr mRNA by inhibiting the 5'-splice site of exon 3. J Biol Chem. 2010;285(41):31537–47. doi: 10.1074/jbc.M109.077453 20685659
42. Tranell A, Tingsborg S, Fenyö EM, Schwartz S. Inhibition of splicing by serine-arginine rich protein 55 (SRp55) causes the appearance of partially spliced HIV-1 mRNAs in the cytoplasm. Virus Res. 2011;157(1):82–91. https://doi.org/10.1016/j.virusres.2011.02.010 21345357
43. Shkreta L, Blanchette M, Toutant J, Wilhelm E, Bell B, Story BA, et al. Modulation of the splicing regulatory function of SRSF10 by a novel compound that impairs HIV-1 replication. Nucleic Acids Res. 2017;45(7):4051–67. doi: 10.1093/nar/gkw1223 27928057
44. Guo J, Hao C, Wang C, Li L. Long noncoding RNA PVT1 modulates hepatocellular carcinoma cell proliferation and apoptosis by recruiting EZH2. Cancer Cell Int. 2018;18 : 98. doi: 10.1186/s12935-018-0582-3 30008615
45. Tripathy MK, McManamy MEM, Burch BD, Archin NM, Margolis DM. H3K27 demethylation at the proviral promoter sensitizes latent HIV to the effects of vorinostat in ex-vivo cultures of resting CD4+ T cells. J Virol. 2015;89 : 8392–405. doi: 10.1128/JVI.00572-15 26041287
46. Zhao Y, Zhao J, Guo X, She J, Liu Y. Long non-coding RNA PVT1, a molecular sponge for miR-149, contributes aberrant metabolic dysfunction and inflammation in IL-1β-simulated osteoarthritic chondrocytes. Biosci Rep. 2018. doi: 10.1042/bsr20180576 30126849
47. Fu C, Li D, Zhang X, Liu N, Chi G, Jin X. LncRNA PVT1 facilitates tumorigenesis and progression of glioma via regulation of miR-128-3p/GREM1 axis and BMP signaling pathway. Neurotherapeutics. 2018. doi: 10.1007/s13311-018-0649-9 30120709
48. He F, Song Z, Chen H, Chen Z, Yang P, Li W, et al. Long noncoding RNA PVT1-214 promotes proliferation and invasion of colorectal cancer by stabilizing Lin28 and interacting with miR-128. Oncogene. 2018. doi: 10.1038/s41388-018-0432-8 30076414
49. Huang F, Chen W, Peng J, Li Y, Zhuang Y, Zhu Z, et al. LncRNA PVT1 triggers Cyto-protective autophagy and promotes pancreatic ductal adenocarcinoma development via the miR-20a-5p/ULK1 Axis. Mol Cancer. 2018;17 : 98. doi: 10.1186/s12943-018-0845-6 30001707
50. Yang Q, Yu Y, Sun Z, Pan Y. Long non-coding RNA PVT1 promotes cell proliferation and invasion through regulating miR-133a in ovarian cancer. Biomed Pharmacother. 2018;106 : 61–7. https://doi.org/10.1016/j.biopha.2018.06.112 29957467
51. Chang Z, Cui J, Song Y. Long noncoding RNA PVT1 promotes EMT via mediating microRNA-186 targeting of Twist1 in prostate cancer. Gene. 2018;654 : 36–42. https://doi.org/10.1016/j.gene.2018.02.036 29452232
52. Henderson LJ, Sharma A, Monaco MCG, Major EO, Al-Harthi L. Human immunodeficiency virus type 1 (HIV-1) transactivator of transcription through its intact core and cysteine-rich domains inhibits Wnt/β-catenin signaling in astrocytes: relevance to HIV neuropathogenesis. J Neurosci. 2012;32(46):16306–13. doi: 10.1523/JNEUROSCI.3145-12.2012 23152614
53. Farivar S, Shaabanpour Aghamaleki F. Effects of major epigenetic factors on systemic lupus erythematosus. Iran Biomed J. 2018;22(5):294–302. doi: 10.29252/ibj.22.5.294 29803202
54. Rai R, Chauhan SK, Singh VV, Rai M, Rai G. RNA-seq analysis reveals unique transcriptome signatures in systemic lupus erythematosus patients with distinct autoantibody specificities. PLoS ONE. 2016;11(11):e0166312–e. doi: 10.1371/journal.pone.0166312 27835693
55. Beliakova-Bethell N, Zhang J, Singhania A, Lee V, Terry V, Richman DD, et al. Suberoylanilide hydroxamic acid induces limited changes in the transcriptome of primary CD4+ T cells. AIDS. 2013;27 : 29–37. doi: 10.1097/QAD.0b013e32835b3e26 23221426
56. Wozniak MB, Villuendas R, Bischoff JR, Aparicio CB, Martínez Leal JF, de La Cueva P, et al. Vorinostat interferes with the signaling transduction pathway of T-cell receptor and synergizes with phosphoinositide-3 kinase inhibitors in cutaneous T-cell lymphoma. Haematologica. 2010;95(4):613–21. doi: 10.3324/haematol.2009.013870 20133897
57. LaBonte M, Wilson P, Fazzone W, Groshen S, Lenz H-J, Ladner R. DNA microarray profiling of genes differentially regulated by the histone deacetylase inhibitors vorinostat and LBH589 in colon cancer cell lines. BMC Med Genomics. 2009;2 : 67. doi: 10.1186/1755-8794-2-67 19948057
58. White CH, Johnston HE, Moesker B, Manousopoulou A, Margolis DM, Richman DD, et al. Mixed effects of suberoylanilide hydroxamic acid (SAHA) on the host transcriptome and proteome and their implications for HIV reactivation from latency. Antiviral Res. 2015;123 : 78–85. doi: 10.1016/j.antiviral.2015.09.002 26343910
59. Macedo AB, Resop RS, Martins LJ, Szaniawski MA, Sorensen ES, Spivak AM, et al. Influence of biological sex, age, and HIV status in an in vitro primary cell model of HIV latency using a CXCR4 tropic virus. AIDS Res Hum Retroviruses. 2018;34(9):769–77. doi: 10.1089/AID.2018.0098 29926732
60. Noyce RS, Taylor K, Ciechonska M, Collins SE, Duncan R, Mossman KL. Membrane perturbation elicits an IRF3-dependent, interferon-independent antiviral response. J Virol. 2011;85(20):10926–31. doi: 10.1128/JVI.00862-11 21813605
61. Noyce RS, Collins SE, Mossman KL. Identification of a novel pathway essential for the immediate-early, interferon-independent antiviral response to enveloped virions. J Virol. 2006;80(1):226–35. doi: 10.1128/JVI.80.1.226-235.2006 16352547
62. Rossio JL, Esser MT, Suryanarayana K, Schneider DK, Bess JW Jr., Vasquez GM, et al. Inactivation of human immunodeficiency virus type 1 infectivity with preservation of conformational and functional integrity of virion surface proteins. J Virol. 1998;72 : 7992–8001. 9733838
63. Park J, Lim CH, Ham S, Kim SS, Choi B-S, Roh T-Y. Genome-wide analysis of histone modifications in latently HIV-1 infected T cells. AIDS. 2014;28(12):1719–28. doi: 10.1097/QAD.0000000000000309 24762674
64. Abdel-Mohsen M, Wang C, Strain MC, Lada SM, Deng X, Cockerham LR, et al. Select host restriction factors are associated with HIV persistence during antiretroviral therapy. AIDS. 2015;29(4):411–20. doi: 10.1097/QAD.0000000000000572 25602681
65. Chen H, Li C, Huang J, Cung T, Seiss K, Beamon J, et al. CD4(+) T cells from elite controllers resist HIV-1 infection by selective upregulation of p21. J Clin Invest. 2011;121(4):1549–60. doi: 10.1172/JCI44539 21403397
66. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25(9):1105–11. doi: 10.1093/bioinformatics/btp120 19289445
67. Anders S, Pyl PT, Huber W. HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31(2):166–9. doi: 10.1093/bioinformatics/btu638 25260700
68. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25–R. doi: 10.1186/gb-2009-10-3-r25 19261174
69. Robinson MD, McCarthy DJ, Smyth GK. EdgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. doi: 10.1093/bioinformatics/btp616 19910308
70. Risso D, Ngai J, Speed TP, Dudoit S. Normalization of RNA-seq data using factor analysis of control genes or samples. Nat Biotechnol. 2014;32(9):896–902. doi: 10.1038/nbt.2931 25150836
71. R: A language and environment for statistical computing. Vienna, Austria: R Foundation of Statistical Computing; R Core Team, 2017.
72. Lawrence M, Huber W, Pagès H, Aboyoun P, Carlson M, Gentleman R, et al. Software for computing and annotating genomic ranges. PLoS Comput Biol. 2013;9(8):e1003118. doi: 10.1371/journal.pcbi.1003118 23950696
73. Beliakova-Bethell N, Massanella M, White C, Lada SM, Du P, Vaida F, et al. The effect of cell subset isolation method on gene expression in leukocytes. Cytometry Part A. 2014;85A(1):94–104. doi: 10.1002/cyto.a.22352 24115734
74. Lefever S, Anckaert J, Volders P-J, Luypaert M, Vandesompele J, Mestdagh P. decodeRNA—predicting non-coding RNA functions using guilt-by-association. Database (Oxford). 2017;2017:bax042. doi: 10.1093/database/bax042 29220434
75. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102 : 15545–50. doi: 10.1073/pnas.0506580102 16199517
76. Nishimura D. BioCarta. Biotech Softw Internet Rep. 2001;2(3):117–20. doi: 10.1089/152791601750294344
77. Kanehisa M, Goto S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000;28(1):27–30. doi: 10.1093/nar/28.1.27 10592173
78. Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13(11):2498–504. doi: 10.1101/gr.1239303 14597658
79. Therneau T, Hart S, Kocher J-P. Calculating sample size estimates for RNA Seq studies. R package version 1.6.0.
80. Pinheiro J, Bates D, DebRoy S, Sarkar D, Team RC. Nlme: linear and nonlinear mixed effects models. R package version 3.1–127. 2016.
Článek A study of psychological pain in substance use disorder and its relationship to treatment outcomeČlánek Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cellsČlánek Temporal weights in loudness: Investigation of the effects of background noise and sound levelČlánek The bacterial community in potato is recruited from soil and partly inherited across generationsČlánek The trajectory of patterns of light and sedentary physical activity among females, ages 14-23Článek Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, ChinaČlánek Honey bee microbiome associated with different hive and sample types over a honey production seasonČlánek Factors influencing bird-building collisions in the downtown area of a major North American cityČlánek Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severityČlánek High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer worldČlánek Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastlineČlánek Primary care in five European countries: A citizens’ perspective on the quality of care for childrenČlánek Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in miceČlánek Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgeneraČlánek Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitisČlánek Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranesČlánek Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cellsČlánek Gender disparities in scientific production: A nationwide assessment among physicians in PeruČlánek Study on the damage characteristics of gas-bearing shale under different unloading stress pathsČlánek Population preferences for breast cancer screening policies: Discrete choice experiment in BelarusČlánek Appropriate management of acute gastroenteritis in Australian children: A population-based studyČlánek More than just availability: Who has access and who administers take-home naloxone in Baltimore, MDČlánek Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humansČlánek Molecular characterisation of genital human papillomavirus among women in Southwestern, NigeriaČlánek Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheepČlánek Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake BayČlánek Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentrationČlánek The effect of climate change on cholera disease: The road ahead using artificial neural networkČlánek UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewalČlánek Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camelsČlánek Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facilityČlánek A digital collection of rare and endangered lemurs and other primates from the Duke Lemur CenterČlánek Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafishČlánek Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horseČlánek Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017Článek Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017Článek Dispersion of Legionella bacteria in atmosphere: A practical source location estimation methodČlánek Moving system with action sport cameras: 3D kinematics of the walking and running in a large volumeČlánek Impacts of risk and competition on the profitability of banks: Empirical evidence from PakistanČlánek Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cellsČlánek Differences in clinical features of cluster headache between drinkers and nondrinkers in JapanČlánek Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancerČlánek Manipulating the odds: The effects of Machiavellianism and construal level on cheating behaviorČlánek Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-AČlánek Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironmentČlánek Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)Článek Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary diseaseČlánek Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapyČlánek Finding phrases: On the role of co-verbal facial information in learning word order in infancyČlánek Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communicationsČlánek The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American womenČlánek Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)Článek Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection statusČlánek An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factorsČlánek Pre-clinical medical student reflections on implicit bias: Implications for learning and teachingČlánek Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stressesČlánek Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cellsČlánek The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomesČlánek Factors associated with persistently high-cost health care utilization for musculoskeletal painČlánek Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative studyČlánek Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysisČlánek Effectiveness of telerehabilitation in the management of adults with stroke: A systematic reviewČlánek Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CTČlánek Determinants of mortality among patients with drug-resistant tuberculosis in northern NigeriaČlánek Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitisČlánek Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, KenyaČlánek TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technologyČlánek Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adultsČlánek Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1Článek The performance of practitioners conducting facial comparisons on images of children across ageČlánek Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPDČlánek Willingness to receive institutional and community-based eldercare among the rural elderly in ChinaČlánek Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel diseaseČlánek An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in MalawiČlánek Migration and political polarization in the U.S.: An analysis of the county-level migration networkČlánek Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriageČlánek Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypassČlánek Location, location, location: Close ties among older continuing care retirement community residentsČlánek Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperaturesČlánek Multiple innate antibacterial immune defense elements are correlated in diverse ungulate speciesČlánek First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from CroatiaČlánek Semantic computational analysis of anticoagulation use in atrial fibrillation from real world dataČlánek A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failureČlánek Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic reviewČlánek Towards successful business process improvement – An extension of change acceleration process modelČlánek Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylaseČlánek HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancerČlánek Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviourČlánek Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2019 Číslo 11- Psilocybin je v Česku od 1. ledna 2026 schválený. Co to znamená v praxi?
- Alergie na antibiotika u žen s infekcemi močových cest − poznatky z průřezové studie z USA
- INFOGRAFIKA: Světový den boje proti rakovině... aneb jaké výzvy stojí před českou onkologií?
- AI pomůže personalizovat léčbu fibrilace síní
- Česká gastroenterologie jde s dobou. Už 80 let
-
Všechny články tohoto čísla
- Wild Steps in a semi-wild setting? Habitat selection and behavior of European bison reintroduced to an enclosure in an anthropogenic landscape
- The effect of facial expression on contrast sensitivity: A behavioural investigation and extension of Hedger, Adams & Garner (2015)
- Non-communicable diseases risk factors and their determinants: A cross-sectional state-wide STEPS survey, Haryana, North India
- Genotype-matched Newcastle disease virus vaccine confers improved protection against genotype XII challenge: The importance of cytoplasmic tails in viral replication and vaccine design
- Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens
- Persistence of traditional and emergence of new structural drivers and factors for the HIV epidemic in rural Uganda; A qualitative study
- Competency assessment of the medical interns and nurses and documenting prevailing practices to provide family planning services in teaching hospitals in three states of India
- Choice of birth place among antenatal clinic attendees in rural mission hospitals in Ebonyi State, South-East Nigeria
- Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol
- Genetic and genomic analyses underpin the feasibility of concomitant genetic improvement of milk yield and mastitis resistance in dairy sheep
- Long-term exposure to daily ethanol injections in DBA/2J and Swiss mice: Lessons for the interpretation of ethanol sensitization
- Taxonomic and functional anuran beta diversity of a subtropical metacommunity respond differentially to environmental and spatial predictors
- A simple way to improve a conventional A/O-MBR for high simultaneous carbon and nutrient removal from synthetic municipal wastewater
- Knowledge and awareness of cervical cancer in Southwestern Ethiopia is lacking: A descriptive analysis
- Flat electrode contacts for vagus nerve stimulation
- Circulating Th17.1 cells as candidate for the prediction of therapeutic response to abatacept in patients with rheumatoid arthritis: An exploratory research
- Prevalence and socioeconomic determinants of development delay among children in Ceará, Brazil: A population-based study
- Characterizing macroinvertebrate community composition and abundance in freshwater tidal wetlands of the Sacramento-San Joaquin Delta
- A randomized controlled trial comparing isosorbide dinitrate-oxytocin versus misoprostol-oxytocin at management of foetal intrauterine death
- Hello, is that me you are looking for? A re-examination of the role of the DMN in social and self relevant aspects of off-task thought
- Lactobacillus rhamnosus Lcr35 as an effective treatment for preventing Candida albicans infection in the invertebrate model Caenorhabditis elegans: First mechanistic insights
- Use of latent class analysis to identify multimorbidity patterns and associated factors in Korean adults aged 50 years and older
- A study of psychological pain in substance use disorder and its relationship to treatment outcome
- Effects of artificially introduced Enterococcus faecalis strains in experimental necrotizing enterocolitis
- Treatment-seeking for vaginal fistula in sub-Saharan Africa
- Dissemination and stakeholder engagement practices among dissemination & implementation scientists: Results from an online survey
- Comparative analysis of the accelerated aged seed transcriptome profiles of two maize chromosome segment substitution lines
- Transactional sex among men who have sex with men participating in the CohMSM prospective cohort study in West Africa
- Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cells
- Left parietal tACS at alpha frequency induces a shift of visuospatial attention
- Microtranscriptome analysis of sugarcane cultivars in response to aluminum stress
- The role of alien species on plant-floral visitor network structure in invaded communities
- Predictive factors for unfavourable treatment in MDR-TB and XDR-TB patients in Rio de Janeiro State, Brazil, 2000-2016
- Agricultural impacts on streams near Nitrate Vulnerable Zones: A case study in the Ebro basin, Northern Spain
- Development of a multi-locus typing scheme for an Enterobacteriaceae linear plasmid that mediates inter-species transfer of flagella
- The roles of MRI-based prostate volume and associated zone-adjusted prostate-specific antigen concentrations in predicting prostate cancer and high-risk prostate cancer
- Re-modeling of foliar membrane lipids in a seagrass allows for growth in phosphorus-deplete conditions
- Effect of sampling frequency on fractal fluctuations during treadmill walking
- Effect of calcium intake and the dietary cation-anion difference during early lactation on the bone mobilization dynamics throughout lactation in dairy cows
- Facilitators and barriers to linkage to HIV care and treatment among female sex workers in a community-based HIV prevention intervention in Tanzania: A qualitative study
- Tuberculosis treatment outcome: The case of women in Ethiopia and China, ten-years retrospective cohort study
- Protein:Protein interactions in the cytoplasmic membrane apparently influencing sugar transport and phosphorylation activities of the e. coli phosphotransferase system
- A digital collection of rare and endangered lemurs and other primates from the Duke Lemur Center
- Computational fluid dynamics simulation of changes in the morphology and airflow dynamics of the upper airways in OSAHS patients after treatment with oral appliances
- Resistome metagenomics from plate to farm: The resistome and microbial composition during food waste feeding and composting on a Vermont poultry farm
- Lower limb chronic edema management program: Perspectives of disengaged patients on challenges, enablers and barriers to program attendance and adherence
- Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing
- Modelling vegetation understory cover using LiDAR metrics
- Assessing the impact of the “one-child policy” in China: A synthetic control approach
- CRISPR-Cas9 modified bacteriophage for treatment of Staphylococcus aureus induced osteomyelitis and soft tissue infection
- Forecasting type-specific seasonal influenza after 26 weeks in the United States using influenza activities in other countries
- Chronic exercise modulates the cellular immunity and its cannabinoid receptors expression
- Characterization of the diverse plasmid pool harbored by the blaNDM-1-containing Acinetobacter bereziniae HPC229 clinical strain
- What does mitogenomics tell us about the evolutionary history of the Drosophila buzzatii cluster (repleta group)?
- A cell-based evaluation of a non-essential amino acid formulation as a non-bioactive control for activation and stimulation of muscle protein synthesis using ex vivo human serum
- Conjugated linoleic acid as a novel insecticide targeting the agricultural pest Leptinotarsa decemlineata
- Relationship between pattern electroretinogram and optic disc morphology in glaucoma
- Depicting changes in land surface cover at Al-Hassa oasis of Saudi Arabia using remote sensing and GIS techniques
- Land snail dispersal, abundance and diversity on green roofs
- Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
- Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: A comparative analysis on the umbilical cord and dental pulp derived Stem/ Stromal Cells secretome
- The association between caesarean section delivery and later life obesity in 21-24 year olds in an Urban South African birth cohort
- Diagnosis and treatment of acute respiratory illness in children under five in primary care in low-, middle-, and high-income countries: A descriptive FRESH AIR study
- Quality control of cervical cytology using a 3-type HPV mRNA test increases screening program sensitivity of cervical intraepithelial neoplasia grade 2+ in young Norwegian women—A cohort study
- Toxicity and sublethal effects of two plant allelochemicals on the demographical traits of cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae)
- Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafish
- Friends with malefit. The effects of keeping dogs and cats, sustaining animal-related injuries and Toxoplasma infection on health and quality of life
- Trueness of digital intraoral impression in reproducing multiple implant position
- Comparison of drug safety data obtained from the monitoring system, literature, and social media: An empirical proof from a Chinese patent medicine
- Norm values and psychometric properties of the short version of the Trier Inventory for Chronic Stress (TICS) in a representative German sample
- Maternal health and birth outcomes in a South African birth cohort study
- Structural characterization of scorpion peptides and their bactericidal activity against clinical isolates of multidrug-resistant bacteria
- Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
- Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
- Residential household yard care practices along urban-exurban gradients in six climatically-diverse U.S. metropolitan areas
- Formal comment on “Assessing the impact of the ‘one-child policy’ in China: A synthetic control approach”
- Evaluation of a global spring wheat panel for stripe rust: Resistance loci validation and novel resources identification
- “Big men” in the office: The gender-specific influence of weight upon persuasiveness
- Modification of everyday activities and its association with self-awareness in cognitively diverse older adults
- The effect of bivalve filtration on eDNA-based detection of aquatic organisms
- Selective culture enrichment and sequencing of feces to enhance detection of antimicrobial resistance genes in third-generation cephalosporin resistant Enterobacteriaceae
- Development and validation of rapid environmental DNA (eDNA) detection methods for bog turtle (Glyptemys muhlenbergii)
- Average and time-specific maternal prenatal inflammatory biomarkers and the risk of labor epidural associated fever
- Preference-based measure of health-related quality of life and its determinants in sickle cell disease in Nigeria
- Factors influencing participation dynamics in research for development interventions with multi-stakeholder platforms: A metric approach to studying stakeholder participation
- Contextual variation in young children’s acquisition of social-emotional skills
- Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries
- Reconciling the statistics of spectral reflectance and colour
- Temporal weights in loudness: Investigation of the effects of background noise and sound level
- A global assessment of street-network sprawl
- Correction: KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species
- Mindfulness-Based Blood Pressure Reduction (MB-BP): Stage 1 single-arm clinical trial
- Measurement of abortion safety using community-based surveys: Findings from three countries
- Behavioral response of naïve and non-naïve deer to wolf urine
- SNARE proteins rescue impaired autophagic flux in Down syndrome
- Negative impact of gestational diabetes mellitus on progress of pelvic floor muscle electromyography activity: Cohort study
- Change in left inferior frontal connectivity with less unexpected harmonic cadence by musical expertise
- Structural mechanism for regulation of DNA binding of BpsR, a Bordetella regulator of biofilm formation, by 6-hydroxynicotinic acid
- How does open innovation lead competitive advantage? A dynamic capability view perspective
- Bull efficiency using dairy genetic traits
- Improved cortical boundary registration for locally distorted fMRI scans
- Extractive single document summarization using binary differential evolution: Optimization of different sentence quality measures
- Measuring the tilt and slant of Chinese handwriting in primary school students: A computerized approach
- Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse
- Sugar labeling: How numerical information of sugar content influences healthiness and tastiness expectations
- Optimally adjusted last cluster for prediction based on balancing the bias and variance by bootstrapping
- Quantifying normal and parkinsonian gait features from home movies: Practical application of a deep learning–based 2D pose estimator
- Heterogeneity of porcine bone marrow-derived dendritic cells induced by GM-CSF
- Can visual interpretation of NucliSens graphs reduce the need for repeat viral load testing?
- Manganese levels in infant formula and young child nutritional beverages in the United States and France: Comparison to breast milk and regulations
- Association between metabolic body composition status and risk for impaired renal function: A cross-sectional study
- Toddler skills predict moderate-to-late preterm born children’s cognition and behaviour at 6 years of age
- The bacterial community in potato is recruited from soil and partly inherited across generations
- Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017
- Patient satisfaction with HIV services in Vietnam: Status, service models and association with treatment outcome
- Ion concentration polarization (ICP) of proteins at silicon micropillar nanogaps
- The trajectory of patterns of light and sedentary physical activity among females, ages 14-23
- Coadministration of kla peptide with HPRP-A1 to enhance anticancer activity
- Measuring the complexity of directed graphs: A polynomial-based approach
- Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, China
- Publication rates in animal research. Extent and characteristics of published and non-published animal studies followed up at two German university medical centres
- Developmental conservation of microRNA gene localization at the nuclear periphery
- Exploring critical factors of the perceived usefulness of blended learning for higher education students
- Anti-Alzheimer potential, metabolomic profiling and molecular docking of green synthesized silver nanoparticles of Lampranthus coccineus and Malephora lutea aqueous extracts
- Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats
- Direct transport vs secondary transfer to level I trauma centers in a French exclusive trauma system: Impact on mortality and determinants of triage on road-traffic victims
- Honey bee microbiome associated with different hive and sample types over a honey production season
- Bacterial communities in the rhizosphere, phyllosphere and endosphere of tomato plants
- Sildenafil citrate long-term treatment effects on cardiovascular reactivity in a SHR experimental model of metabolic syndrome
- Postoperative delirium after lung resection for primary lung cancer: Risk factors, risk scoring system, and prognosis
- The CSF-1-receptor inhibitor, JNJ-40346527 (PRV-6527), reduced inflammatory macrophage recruitment to the intestinal mucosa and suppressed murine T cell mediated colitis
- Using Er:YAG laser to remove lithium disilicate crowns from zirconia implant abutments: An in vitro study
- Antibacterial efficacy of cold atmospheric plasma against Enterococcus faecalis planktonic cultures and biofilms in vitro
- Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages
- Application of ensemble methods to analyse the decline of organochlorine pesticides in relation to the interactions between age, gender and time
- Mitogenomic diversity in Sacred Ibis Mummies sheds light on early Egyptian practices
- Automated detection of a nonperfusion area caused by retinal vein occlusion in optical coherence tomography angiography images using deep learning
- Characterisation of a novel SCCmec VI element harbouring fusC in an emerging Staphylococcus aureus strain from the Arabian Gulf region
- Inducible UCP1 silencing: A lentiviral RNA-interference approach to quantify the contribution of beige fat to energy homeostasis
- iCrotoK-PseAAC: Identify lysine crotonylation sites by blending position relative statistical features according to the Chou’s 5-step rule
- Emerging practices supporting diabetes self-management among food insecure adults and families: A scoping review
- Does aneurysm side influence the infarction side and patients´ outcome after subarachnoid hemorrhage?
- Raising the bar: Recovery ambition for species at risk in Canada and the US
- Management of locally advanced non-small cell lung cancer in the modern era: A national Italian survey on diagnosis, treatment and multidisciplinary approach
- Foraging strategies are maintained despite workforce reduction: A multidisciplinary survey on the pollen collected by a social pollinator
- Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017
- Integrated analysis of miRNA landscape and cellular networking pathways in stage-specific prostate cancer
- Evaluation of the reactogenicity, adjuvanticity and antigenicity of LT(R192G) and LT(R192G/L211A) by intradermal immunization in mice
- Role of rhesus macaque IFITM3(2) in simian immunodeficiency virus infection of macaques
- Variation in the LRR region of Pi54 protein alters its interaction with the AvrPi54 protein revealed by in silico analysis
- Evolutionarily conserved susceptibility of the mitochondrial respiratory chain to SDHI pesticides and its consequence on the impact of SDHIs on human cultured cells
- Statistical determination of synergy based on Bliss definition of drugs independence
- The association between sleep problems and academic performance in primary school-aged children: Findings from a Norwegian longitudinal population-based study
- Estimating the national cost burden of in-hospital needlestick injuries among healthcare workers in Japan
- Assessing reliability of intra-tumor heterogeneity estimates from single sample whole exome sequencing data
- Dispersion of Legionella bacteria in atmosphere: A practical source location estimation method
- Integrative proteomic and phosphoproteomic profiling of prostate cell lines
- Treatment paths for localised prostate cancer in Italy: The results of a multidisciplinary, observational, prospective study (Pros-IT CNR)
- Why are undergraduate emerging adults anxious and avoidant in their romantic relationships? The role of family relationships
- Barriers to implementation of emergency obstetric and neonatal care in rural Pakistan
- Testosterone supplementation improves insulin responsiveness in HFD fed male T2DM mice and potentiates insulin signaling in the skeletal muscle and C2C12 myocyte cell line
- Ang-(1-7)/ MAS1 receptor axis inhibits allergic airway inflammation via blockade of Src-mediated EGFR transactivation in a murine model of asthma
- Factors influencing bird-building collisions in the downtown area of a major North American city
- Collembola laterally move biochar particles
- Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severity
- Moving system with action sport cameras: 3D kinematics of the walking and running in a large volume
- Factors influencing subclinical atherosclerosis in patients with biopsy-proven nonalcoholic fatty liver disease
- Boundary violations and adolescent drinking: Observational evidence that symbolic boundaries moderate social influence
- Inadequate conflict of interest policies at most French teaching hospitals: A survey and website analysis
- A new resolution function to evaluate tree shape statistics
- Thermostat wars? The roles of gender and thermal comfort negotiations in household energy use behavior
- Patients undergoing surgery for lumbar spinal stenosis experience unique courses of pain and disability: A group-based trajectory analysis
- Lifetime prevalence of intimate partner violence against women in an urban Brazilian city: A cross-sectional survey
- The factors associated with being left-behind children in China: Multilevel analysis with nationally representative data
- High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer world
- Quantifying pediatric patient need for second- and third-line HIV treatment: A tool for decision-making in resource-limited settings
- Discovery of actionable genetic alterations with targeted panel sequencing in children with relapsed or refractory solid tumors
- Iodine status of non-pregnant women and availability of food vehicles for fortification with iodine in a remote community in Gulf province, Papua New Guinea
- Fibre and extracellular matrix contributions to passive forces in human skeletal muscles: An experimental based constitutive law for numerical modelling of the passive element in the classical Hill-type three element model
- The status of imported Barremian-Bedoulian flint in north-eastern Iberia during the Middle Neolithic. Insights from the variscite mines of Gavà (Barcelona)
- Psychology of personal data donation
- Radiocarbon dating and cultural dynamics across Mongolia’s early pastoral transition
- MARGO (Massively Automated Real-time GUI for Object-tracking), a platform for high-throughput ethology
- Visual detection of time-varying signals: Opposing biases and their timescales
- Results from a World Health Organization pilot of the Basic Emergency Care Course in Sub Saharan Africa
- Scientists’ opinions and attitudes towards citizens’ understanding of science and their role in public engagement activities
- Dacentrurine stegosaurs (Dinosauria): A new specimen of Miragaia longicollum from the Late Jurassic of Portugal resolves taxonomical validity and shows the occurrence of the clade in North America
- Integrated pan-cancer gene expression and drug sensitivity analysis reveals SLFN11 mRNA as a solid tumor biomarker predictive of sensitivity to DNA-damaging chemotherapy
- Does membrane feeding compromise the quality of Aedes aegypti mosquitoes?
- Morphology, phylogeny, and taxonomy of two species of colonial volvocine green algae from Lake Victoria, Tanzania
- Metabolomics profiles associated with HbA1c levels in patients with type 2 diabetes
- Exploring local realities: Perceptions and experiences of healthcare workers on the management and control of drug-resistant tuberculosis in Addis Ababa, Ethiopia
- Sex differences in the treatment and outcome of emergency general surgery
- Comorbidities and costs in HIV patients: A retrospective claims database analysis in Germany
- Barriers to integration of bioinformatics into undergraduate life sciences education: A national study of US life sciences faculty uncover significant barriers to integrating bioinformatics into undergraduate instruction
- Local unemployment changes the springboard effect of low pay: Evidence from England
- A comparison of body composition assessment methods in climbers: Which is better?
- Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples
- Elucidating genetic variability and population structure in Venturia inaequalis associated with apple scab diseaseusing SSR markers
- Clustering via hypergraph modularity
- Indomethacin enhances anti-tumor efficacy of a MUC1 peptide vaccine against breast cancer in MUC1 transgenic mice
- Multistage fuzzy comprehensive evaluation of landslide hazards based on a cloud model
- Inducible microRNA-200c decreases motility of breast cancer cells and reduces filamin A
- Pharmacological signatures of the reduced incidence and the progression of cognitive decline in ageing populations suggest the protective role of beneficial polypharmacy
- Continuous influenza virus production in a tubular bioreactor system provides stable titers and avoids the “von Magnus effect”
- Complex interaction networks of cytokines after transarterial chemotherapy in patients with hepatocellular carcinoma
- Gender essentialism in transgender and cisgender children
- Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae
- Being there: A scoping review of grief support training in medical education
- Does the psychological profile influence the position of promising young futsal players?
- Effect of self-rated health status on functioning difficulties among older adults in Ghana: Coarsened exact matching method of analysis of the World Health Organization’s study on global AGEing and adult health, Wave 2
- Olfactory screening of Parkinson’s Disease patients and healthy subjects in China and Germany: A study of cross-cultural adaptation of the Sniffin’ Sticks 12-identification test
- Molecular evolution of cytochrome C oxidase-I protein of insects living in Saudi Arabia
- Correlates of leisure-time sedentary behavior among 181,793 adolescents aged 12-15 years from 66 low- and middle-income countries
- Cost-effectiveness analysis of Mucosal Leishmaniasis diagnosis with PCR-based vs parasitological tests in Colombia
- Spatiotemporal analysis of historical records (2001–2012) on dengue fever in Vietnam and development of a statistical model for forecasting risk
- Resilience assessment of Puerto Rico’s coral reefs to inform reef management
- Effect of community based health education on knowledge and attitude towards iron and folic acid supplementation among pregnant women in Kiambu County, Kenya: A quasi experimental study
- Implementation and effectiveness of non-specialist mediated interventions for children with Autism Spectrum Disorder: A systematic review and meta-analysis
- A tailored cognitive behavioral program for juvenile justice-referred females at risk of substance use and delinquency: A pilot quasi-experimental trial
- Impact of adjusted kidney volume measured in the bench surgery on one-year renal function in kidney transplantation
- Machine learning algorithm validation with a limited sample size
- The magnitude of suicidal ideation, attempts and associated factors of HIV positive youth attending ART follow ups at St. Paul’s hospital Millennium Medical College and St. Peter’s specialized hospital, Addis Ababa, Ethiopia, 2018
- The nonlinear effect of financial and fiscal policies on poverty alleviation in China—An empirical analysis of Chinese 382 impoverished counties with PSTR models
- Impacts of risk and competition on the profitability of banks: Empirical evidence from Pakistan
- Molecular characterization of lung adenocarcinoma from Korean patients using next generation sequencing
- An expansin-like protein expands forage cell walls and synergistically increases hydrolysis, digestibility and fermentation of livestock feeds by fibrolytic enzymes
- Joint image compression and encryption based on sparse Bayesian learning and bit-level 3D Arnold cat maps
- Urticating setae of tarantulas (Araneae: Theraphosidae): Morphology, revision of typology and terminology and implications for taxonomy
- Live observation of the oviposition process in Daphnia magna
- On the accuracy of displacement-based wave intensity analysis: Effect of vessel wall viscoelasticity and nonlinearity
- Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on Signy Island, South Orkney Islands, Antarctica
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- Characterizing the Randot Preschool stereotest: Testability, norms, reliability, specificity and sensitivity in children aged 2-11 years
- Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cells
- Amazon climatic factors driving terpene composition of Iryanthera polyneura Ducke in terra-firme forest: A statistical approach
- Differences in clinical features of cluster headache between drinkers and nondrinkers in Japan
- Distribution of macular ganglion cell layer thickness in foveal hypoplasia: A new diagnostic criterion for ocular albinism
- Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancer
- Effect of mechanochemical activation of natural phosphorite structure as well as phosphorus solubility
- Automated content analysis across six languages
- A deep learning reconstruction framework for X-ray computed tomography with incomplete data
- Integrating interconception care in preventive child health care services: The Healthy Pregnancy 4 All program
- The prognostic significance of tumor-infiltrating lymphocytes assessment with hematoxylin and eosin sections in resected primary lung adenocarcinoma
- Effectiveness of novel fabrics to resist punctures and lacerations from white shark (Carcharodon carcharias): Implications to reduce injuries from shark bites
- Bacillus Calmette-Guérin (BCG) therapy lowers the incidence of Alzheimer’s disease in bladder cancer patients
- Serial block-face scanning electron microscopy reveals neuronal-epithelial cell fusion in the mouse cornea
- Salt or fish (or salted fish)? The Bronze Age specialised sites along the Tyrrhenian coast of Central Italy: New insights from Caprolace settlement
- Pragmatic language dysfunction in systemic lupus erythematosus patients: Results from a single center Italian study
- Association between cerebral atrophy and osteoporotic vertebral compression fractures
- Latitudinal gradient of cyanobacterial diversity in tidal flats
- Gene expression based survival prediction for cancer patients—A topic modeling approach
- Understanding allergic multimorbidity within the non-eosinophilic interactome
- The association between psychological distress and angina pectoris: A population-based study
- Comparative analysis on Facebook post interaction using DNN, ELM and LSTM
- Cerebellum-mediated trainability of eye and head movements for dynamic gazing
- Psychological and physiological effects of applying self-control to the mobile phone
- Omecamtiv mecarbil lowers the contractile deficit in a mouse model of nebulin-based nemaline myopathy
- Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastline
- Modulating transcription through development of semi-synthetic yeast core promoters
- Left-handed metamaterial bandpass filter for GPS, Earth Exploration-Satellite and WiMAX frequency sensing applications
- Cost-effectiveness analysis of PSA-based mass screening: Evidence from a randomised controlled trial combined with register data
- A good tennis player does not lose matches. The effects of valence congruency in processing stance-argument pairs
- Validation of the group tasks uncertainty model (MITAG) in a German sample
- Parent psychological wellbeing in a single-family room versus an open bay neonatal intensive care unit
- Optimizing the procedure of grain nutrient predictions in barley via hyperspectral imaging
- In-situ time resolved spectrographic measurement using an additively manufactured metallic micro-fluidic analysis platform
- Race disparity in blood sphingolipidomics associated with lupus cardiovascular comorbidity
- Characterization of the placental transcriptome through mid to late gestation in the mare
- Indirect violence exposure and mental health symptoms among an urban public-school population: Prevalence and correlates
- Diagnostic ability of multifocal electroretinogram in early multiple sclerosis using a new signal analysis method
- Predictors of never having a mammogram among Chinese, Vietnamese, and Korean immigrant women in the U.S.
- The impact of hepatic steatosis on portal hypertension
- How do and could clinical guidelines support patient-centred care for women: Content analysis of guidelines
- Study of the epidemiological behavior of malaria in the Darien Region, Panama. 2015–2017
- School-based obesity prevention for busy low-income families—Organisational and personal barriers and facilitators to implementation
- Neighborhood crime, disorder and substance use in the Caribbean context: Jamaica National Drug Use Prevalence Survey 2016
- Genomic comparison of diverse Salmonella serovars isolated from swine
- Significance of the lobe-specific emphysema index to predict prolonged air leak after anatomical segmentectomy
- Modeling of inter-organizational coordination dynamics in resilience planning of infrastructure systems: A multilayer network simulation framework
- Manipulating the odds: The effects of Machiavellianism and construal level on cheating behavior
- Early recognition of anorexia through patient-generated assessment predicts survival in patients with oesophagogastric cancer
- Identifying publications in questionable journals in the context of performance-based research funding
- ITGAM is a risk factor to systemic lupus erythematosus and possibly a protection factor to rheumatoid arthritis in patients from Mexico
- Nurses’ and patients’ experiences and preferences of the ankle-brachial pressure index and multi-site photoplethysmography for the diagnosis of peripheral arterial disease: A qualitative study
- Cluster tendency assessment in neuronal spike data
- Voluntary medical male circumcision for HIV prevention among adolescents in Kenya: Unintended consequences of pursuing service-delivery targets
- Primary care in five European countries: A citizens’ perspective on the quality of care for children
- High Order Profile Expansion to tackle the new user problem on recommender systems
- Psychometric properties of the Korean version of the Health Literacy on Social Determinants of Health Questionnaire (K-HL-SDHQ)
- Flood hazard mapping and assessment in data-scarce Nyaungdon area, Myanmar
- Methods for the identification of farm escapees in feral mink (Neovison vison) populations
- Transcriptional analysis of amino acid, metal ion, vitamin and carbohydrate uptake in butanol-producing Clostridium beijerinckii NRRL B-598
- Long-term vancomycin use had low risk of ototoxicity
- Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-A
- Exploration of muscle loss and metabolic state during prolonged critical illness: Implications for intervention?
- Pan-caspase inhibitor F573 mitigates liver ischemia reperfusion injury in a murine model
- Efficacy of interleukin 10 gene hydrofection in pig liver vascular isolated ‘in vivo’ by surgical procedure with interest in liver transplantation
- Molecular characteristics of segment 5, a unique fragment encoding two partially overlapping ORFs in the genome of rice black-streaked dwarf virus
- Early economic evaluation of MRI-guided laser interstitial thermal therapy (MRgLITT) and epilepsy surgery for mesial temporal lobe epilepsy
- GLADS: A gel-less approach for detection of STMS markers in wheat and rice
- Anterior tooth-use behaviors among early modern humans and Neandertals
- Incidence patterns of orofacial clefts in purebred dogs
- Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in mice
- Association of thoracic spine deformity and cardiovascular disease in a mouse model for Marfan syndrome
- Predicting atrial fibrillation in primary care using machine learning
- M3VR—A multi-stage, multi-resolution, and multi-volumes-of-interest volume registration method applied to 3D endovaginal ultrasound
- A developmental trajectory supporting the evaluation and achievement of competencies: Articulating the Mastery Rubric for the nurse practitioner (MR-NP) program curriculum
- Mobile medication manager application to improve adherence with immunosuppressive therapy in renal transplant recipients: A randomized controlled trial
- Default Mode Network structural alterations in Kocher-Monro trajectory white matter transection: A 3 and 7 tesla simulation modeling approach
- Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgenera
- Population genetic analysis of 36 Y-chromosomal STRs yields comprehensive insights into the forensic features and phylogenetic relationship of Chinese Tai-Kadai-speaking Bouyei
- Prevention of suicidal behaviour: Results of a controlled community-based intervention study in four European countries
- An assessment of khat consumption habit and its linkage to household economies and work culture: The case of Harar city
- Fixation of genetic variation and optimization of gene expression: The speed of evolution in isolated lizard populations undergoing Reverse Island Syndrome
- One simple claudication question as first step in Peripheral Arterial Disease (PAD) screening: A meta-analysis of the association with reduced Ankle Brachial Index (ABI) in 27,945 subjects
- Direct cost of health care for individuals with community associated Clostridium difficile infections: A population-based cohort study
- Association between serum homocysteine level and cognitive function in middle-aged type 2 diabetes mellitus patients
- A qualitative research synthesis of contextual factors contributing to female overweight and obesity over the life course in sub-Saharan Africa
- Insight into the relationship between aryl-hydrocarbon receptor and β-catenin in human colon cancer cells
- Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitis
- The role of stigma in the acceptance and disclosure of HIV among recently diagnosed men who have sex with men in Australia: A qualitative study
- Detection of Schistosoma japonicum and Oncomelania hupensis quadrasi environmental DNA and its potential utility to schistosomiasis japonica surveillance in the Philippines
- Does age influence the quality of life in children with atopic dermatitis?
- Questioning the lasting effect of galvanic vestibular stimulation on postural control
- Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironment
- Characterization of 20 complete plastomes from the tribe Laureae (Lauraceae) and distribution of small inversions
- Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranes
- Recent climate-driven ecological change across a continent as perceived through local ecological knowledge
- Nonalcoholic fatty liver disease is an early predictor of metabolic diseases in a metabolically healthy population
- Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China
- Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
- Gender disparities in scientific production: A nationwide assessment among physicians in Peru
- Effect of F1 and F2 generations on genetic variability and working steps of doubled haploid production in maize
- Mitochondrial dysfunction in rheumatoid arthritis: A comprehensive analysis by integrating gene expression, protein-protein interactions and gene ontology data
- A caspase-6-cleaved fragment of Glial Fibrillary Acidic Protein as a potential serological biomarker of CNS injury after cardiac arrest
- A handy method to remove bacterial contamination from fungal cultures
- The self-care profiles and its determinants among adults with hypertension in primary health care clinics in Selangor, Malaysia
- The mutational landscape of quinolone resistance in Escherichia coli
- Exploring the influence of self-perceptions on the relationship between motor competence and identity in adolescents
- Study on the damage characteristics of gas-bearing shale under different unloading stress paths
- EPILAT-IRA Study: A contribution to the understanding of the epidemiology of acute kidney injury in Latin America
- 16S rDNA droplet digital PCR for monitoring bacterial DNAemia in bloodstream infections
- Three-dimensional (3D) brain microphysiological system for organophosphates and neurochemical agent toxicity screening
- Diversity of endocervical microbiota associated with genital Chlamydia trachomatis infection and infertility among women visiting obstetrics and gynecology clinics in Malaysia
- Health impact of hepatic-venous-occlusive disease in a small town in Ethiopia—Case study from Tahtay koraro district in Tigray region, 2017
- Development of a novel automatable fabrication method based on electrospinning co electrospraying for rotator cuff augmentation patches
- Development of a quantitative PCR assay for the detection and enumeration of a potentially ciguatoxin-producing dinoflagellate, Gambierdiscus lapillus (Gonyaulacales, Dinophyceae)
- Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)
- Seasonal oyster harvesting recorded in a Late Archaic period shell ring
- Population preferences for breast cancer screening policies: Discrete choice experiment in Belarus
- Respiratory health and inflammatory markers - Exposure to respirable dust and quartz and chemical binders in Swedish iron foundries
- Trends and predictors of mother-to-child transmission of HIV in an era of protocol changes: Findings from two large health facilities in North East Nigeria
- Elevated Ki-67 (MIB-1) expression as an independent predictor for unfavorable pathologic outcomes and biochemical recurrence after radical prostatectomy in patients with localized prostate cancer: A propensity score matched study
- Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. tumida)
- Carvedilol improves glucose tolerance and insulin sensitivity in treatment of adrenergic overdrive in high fat diet-induced obesity in mice
- Institutional differences in USMLE Step 1 and 2 CK performance: Cross-sectional study of 89 US allopathic medical schools
- Molecular epidemiological characteristics of dengue virus carried by 34 patients in Guangzhou in 2018
- Heteroplasmy in the complete chicken mitochondrial genome
- Candida blood stream infections observed between 2011 and 2016 in a large Italian University Hospital: A time-based retrospective analysis on epidemiology, biofilm production, antifungal agents consumption and drug-susceptibility
- Sixty years since the creation of Lake Kariba: Thermal and oxygen dynamics in the riverine and lacustrine sub-basins
- Association of uric acid in serum and urine with subclinical renal damage: Hanzhong Adolescent Hypertension Study
- Appropriate management of acute gastroenteritis in Australian children: A population-based study
- The plasma metabolome of women in early pregnancy differs from that of non-pregnant women
- Effectiveness of four types of neuraminidase inhibitors approved in Japan for the treatment of influenza
- More than just availability: Who has access and who administers take-home naloxone in Baltimore, MD
- Evaluating the cross-cultural validity of the Dutch version of the Social Exclusion Index for Health Surveys (SEI-HS): A mixed methods study
- Diminuendo al bottom—Clarifying the semantics of music notation by re-modeling
- Structural analysis of the manganese transport regulator MntR from Bacillus halodurans in apo and manganese bound forms
- Serum uromodulin is associated with the severity of clinicopathological findings in ANCA-associated glomerulonephritis
- Male support for cervical cancer screening and treatment in rural Ghana
- ADAPTS: Automated deconvolution augmentation of profiles for tissue specific cells
- Comparison of shape quantification methods for genomic prediction, and genome-wide association study of sorghum seed morphology
- An attempt to identify the issues underlying the lack of consistent conceptualisations in the field of student mathematics-related beliefs
- Video abstracts and plain language summaries are more effective than graphical abstracts and published abstracts
- Trophic structure of the macrofauna associated to deep-vents of the southern Gulf of California: Pescadero Basin and Pescadero Transform Fault
- Incomplete insertion of pedicle screws in a standard construct reduces the fatigue life: A biomechanical analysis
- Cost savings associated with timely treatment of botulism with botulism antitoxin heptavalent product
- Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains
- Early signal detection of adverse events following influenza vaccination using proportional reporting ratio, Victoria, Australia
- Bioinformatic analysis of a novel Echinococcus granulosus nuclear receptor with two DNA binding domains
- Genome-wide identification and characterization, phylogenetic comparison and expression profiles of SPL transcription factor family in B. juncea (Cruciferae)
- Hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes
- Conceptualising alcohol consumption in relation to long-term health conditions: Exploring risk in interviewee accounts of drinking and taking medications
- Elevated interleukin-25 and its association to Th2 cytokines in systemic lupus erythematosus with lupus nephritis
- Thrombocytopenia and thrombocytosis are associated with different outcome in atrial fibrillation patients on anticoagulant therapy
- Involvement of extracellular vesicles in the macrophage-tumor cell communication in head and neck squamous cell carcinoma
- Comparison of Humphrey Field Analyzer and imo visual field test results in patients with glaucoma and pseudo-fixation loss
- Out-of-pocket expenditure and catastrophic health expenditure for hospitalization due to injuries in public sector hospitals in North India
- Concurrent validity and discriminative ability of Dutch performance-based motor tests in 5 to 6 years old children
- Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Can General Practitioners manage mental disorders in primary care? A partially randomised, pragmatic, cluster trial
- Self-serving incentives impair collective decisions by increasing conformity
- Mutation and immune profiling of metaplastic breast cancer: Correlation with survival
- The clinicopathological significance of Thrombospondin-4 expression in the tumor microenvironment of gastric cancer
- Propofol-based total intravenous anesthesia did not improve survival compared to desflurane anesthesia in breast cancer surgery
- Association between ossification of the posterior longitudinal ligament and ossification of the nuchal ligament in the cervical spine
- Effects of Debaryomyces hansenii treatment on intestinal mucosa microecology in mice with antibiotic-associated diarrhea
- Molecular validation of clinical Pantoea isolates identified by MALDI-TOF
- A novel wheat lodging resistance evaluation method and device based on the thrust force of the stalks
- Evolution of high tooth replacement rates in theropod dinosaurs
- Outpatient facility-based order variation in combined imaging
- Ethnic-racial identity affirmation: Validation in Aboriginal Australian children
- Non-intubated anesthesia in patients undergoing video-assisted thoracoscopic surgery: A systematic review and meta-analysis
- Tissue-type plasminogen activator selectively inhibits multiple toll-like receptors in CSF-1-differentiated macrophages
- Changes of serum pentraxin-3 and hypersensitive CRP levels during pregnancy and their relationship with gestational diabetes mellitus
- Synergistic immuno-modulatory activity in human macrophages of a medicinal mushroom formulation consisting of Reishi, Shiitake and Maitake
- Investigating reindeer pastoralism and exploitation of high mountain zones in northern Mongolia through ice patch archaeology
- Diversity pattern of Plasmodium knowlesi merozoite surface protein 4 (MSP4) in natural population of Malaysia
- Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humans
- “What gets measured better gets done better”: The landscape of validation of global maternal and newborn health indicators through key informant interviews
- Contactless monitoring of heart and respiratory rate in anesthetized pigs using infrared thermography
- Molecular characterisation of genital human papillomavirus among women in Southwestern, Nigeria
- The impact of “male clinics” on health-seeking behaviors of adult men in rural Kenya
- Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary disease
- Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapy
- Impact of negative tuberculin skin test on growth among disadvantaged Bangladeshi children
- Streptococcal phosphotransferase system imports unsaturated hyaluronan disaccharide derived from host extracellular matrices
- Maternal diet modulates placental nutrient transporter gene expression in a mouse model of diabetic pregnancy
- Effects of an incremental theory of personality intervention on the reciprocity between bullying and cyberbullying victimization and perpetration in adolescents
- The clot thickens: Autologous and allogeneic fibrin sealants are mechanically equivalent in an ex vivo model of cartilage repair
- Reproducibility, stability, and accuracy of microbial profiles by fecal sample collection method in three distinct populations
- Cooperation with autonomous machines through culture and emotion
- Variation in hybridogenetic hybrid emergence between populations of water frogs from the Pelophylax esculentus complex
- Breast cancer in Tanzanian, black American, and white American women: An assessment of prognostic and predictive features, including tumor infiltrating lymphocytes
- Intramolecular tautomerization of the quercetin molecule due to the proton transfer: QM computational study
- A global overview of cassava genetic diversity
- Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheep
- Identifying resurrection genes through the differentially expressed genes between Selaginella tamariscina (Beauv.) spring and Selaginella moellendorffii Hieron under drought stress
- Impact of hemodialysis on the concentrations of sodium and potassium during infusion of sodium thiosulfate using an In Vitro hemodialysis model
- Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake Bay
- Suboptimal infant and young child feeding practices in rural Boucle du Mouhoun, Burkina Faso: Findings from a cross-sectional population-based survey
- High salinity tolerance of invasive blue catfish suggests potential for further range expansion in the Chesapeake Bay region
- From waste to food: Optimising the breakdown of oil palm waste to provide substrate for insects farmed as animal feed
- Quantitative assessment of interstitial lung disease in Sjögren’s syndrome
- Comparative efficacy of tenofovir and entecavir in nucleos(t)ide analogue-naive chronic hepatitis B: A systematic review and meta-analysis
- Reference ranges for ultrasonographic renal dimensions as functions of age and body indices: A retrospective observational study in Taiwan
- Finding phrases: On the role of co-verbal facial information in learning word order in infancy
- Mathematical modeling reveals the factors involved in the phenomena of cancer stem cells stabilization
- Effects of forest management and roe deer impact on a mountain forest development in the Italian Apennines: A modelling approach using LANDIS-II
- Evaluation of comprehensive improvement for mild and moderate soil salinization in arid zone
- Efficacy, acceptability and feasibility of daily text-messaging in promoting glycaemic control and other clinical outcomes in a low-resource setting of South Africa: A randomised controlled trial
- Magnitude and associated factors of postpartum depression among women in Nekemte town, East Wollega zone, west Ethiopia, 2019: A community-based study
- Comparison of continuous wave and cold lateral condensation filling techniques in 3D printed simulated C-shape canals instrumented with Reciproc Blue or Hyflex EDM
- Effect of caffeine on neuromuscular function following eccentric-based exercise
- AtUBL5 regulates growth and development through pre-mRNA splicing in Arabidopsis thaliana
- The gut microbiome of freshwater Unionidae mussels is determined by host species and is selectively retained from filtered seston
- Alcohol consumption and survival after breast cancer diagnosis in Japanese women: A prospective patient cohort study
- Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions
- The household economic costs associated with depression symptoms: A cross-sectional household study conducted in the North West province of South Africa
- Increased cell size, structural complexity and migration of cancer cells acquiring fibroblast organelles by cell-projection pumping
- Acute low- compared to high-load resistance training to failure results in greater energy expenditure during exercise in healthy young men
- Impact of body mass index and metabolically unhealthy status on mortality in the Japanese general population: The JMS cohort study
- Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis
- Ecohydrology of urban trees under passive and active irrigation in a semiarid city
- Cyclosporine A eyedrops with self-nanoemulsifying drug delivery systems have improved physicochemical properties and efficacy against dry eye disease in a murine dry eye model
- LFastqC: A lossless non-reference-based FASTQ compressor
- Highly accurate prediction of flammability limits of chemical compounds using novel integrated hybrid models
- Nonsteroidal anti-inflammatory drugs and acetaminophen ameliorate muscular mechanical hyperalgesia developed after lengthening contractions via cyclooxygenase-2 independent mechanisms in rats
- A popular Indian clove-based mosquito repellent is less effective against Culex quinquefasciatus and Aedes aegypti than DEET
- Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentration
- The effect of climate change on cholera disease: The road ahead using artificial neural network
- Grit (effortful persistence) can be measured with a short scale, shows little variation across socio-demographic subgroups, and is associated with career success and career engagement
- Micro-dislodgement during transcatheter aortic valve implantation with a contemporary self-expandable prosthesis
- Improving the antimicrobial efficacy against resistant Staphylococcus aureus by a combined use of conjugated oligoelectrolytes
- Kin discrimination and outer membrane exchange in Myxococcus xanthus: Experimental analysis of a natural population
- Inflammatory cell infiltrates, hypoxia, vascularization, pentraxin 3 and osteoprotegerin in abdominal aortic aneurysms – A quantitative histological study
- Effects of virtual reality rehabilitation training on gait and balance in patients with Parkinson's disease: A systematic review
- Serum miR-33a is associated with steatosis and inflammation in patients with non-alcoholic fatty liver disease after liver transplantation
- Association between housing tenure and self-rated health in Japan: Findings from a nationwide cross-sectional survey
- Investigation of biochemical and physiological parameters of the newborn Saiga antelope (Saiga tatarica) in Gansu Province, China
- One-year follow-up of changes in refraction and aberrations induced by corneal incision
- Evaluation of upper limb superficial venous percussion as a sign of anatomical location and venous permeability. A comparative study of superficial venous percussion to ultrasound findings on non-renal patients and on chronic kidney disease patients
- An assessment of the Dutch experience with health insurers acting as healthcare advisors
- Perception of potential harm and benefits of HIV vaccine trial participation: A qualitative study from urban Tanzania
- Veterans with Gulf War Illness exhibit distinct respiratory patterns during maximal cardiopulmonary exercise
- Deep brain stimulation restores the glutamatergic and GABAergic synaptic transmission and plasticity to normal levels in kindled rats
- Metformin strongly affects transcriptome of peripheral blood cells in healthy individuals
- Cranberry extracts promote growth of Bacteroidaceae and decrease abundance of Enterobacteriaceae in a human gut simulator model
- Long-term retention on antiretroviral therapy among infants, children, adolescents and adults in Malawi: A cohort study
- Histochemical quantification of collagen content in articular cartilage
- Optogenetically transduced human ES cell-derived neural progenitors and their neuronal progenies: Phenotypic characterization and responses to optical stimulation
- Ion torrent high throughput mitochondrial genome sequencing (HTMGS)
- Outpatient antibiotic prescription rate and pattern in the private sector in India: Evidence from medical audit data
- Acute Influenza A virus outbreak in an enzootic infected sow herd: Impact on viral dynamics, genetic and antigenic variability and effect of maternally derived antibodies and vaccination
- Prevalence and correlates of low serum calcium in late pregnancy: A cross sectional study in the Nkongsamba Regional Hospital; Littoral Region of Cameroon
- Home-cage monitoring ascertains signatures of ictal and interictal behavior in mouse models of generalized seizures
- CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say
- Genetic susceptibility to angiotensin-converting enzyme-inhibitor induced angioedema: A systematic review and evaluation of methodological approaches
- Proton pump inhibitor use increases the risk of peritonitis in peritoneal dialysis patients
- Comparative distribution of extended-spectrum beta-lactamase–producing Escherichia coli from urine infections and environmental waters
- Sex differences in thigh muscle volumes, sprint performance and mechanical properties in national-level sprinters
- Maternal serum and cord blood leptin concentrations at delivery
- Winter nitrification in ice-covered lakes
- Intolerance of uncertainty fuels depressive symptoms through rumination: Cross-sectional and longitudinal studies
- Monitoring exercise-induced muscle damage indicators and myoelectric activity during two weeks of knee extensor exercise training in young and old men
- Can adoption of pollution prevention techniques reduce pollution substitution?
- The association between self-efficacy and self-management behaviors among Chinese patients with type 2 diabetes
- Poly-arginine-18 peptides do not exacerbate bleeding, or improve functional outcomes following collagenase-induced intracerebral hemorrhage in the rat
- Affective disorders in the elderly in different European countries: Results from the MentDis_ICF65+ study
- Evaluation of forearm vascular resistance during orthostatic stress: Velocity is proportional to flow and size doesn’t matter
- Proton pencil minibeam irradiation of an in-vivo mouse ear model spares healthy tissue dependent on beam size
- Maternal stress in Shank3ex4-9 mice increases pup-directed care and alters brain white matter in male offspring
- Aspartate aminotransferase-to-platelet ratio index (APRI): A potential marker for diagnosis in patients at risk of severe malaria caused by Plasmodium vivax
- Exploiting open source 3D printer architecture for laboratory robotics to automate high-throughput time-lapse imaging for analytical microbiology
- Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
- Clinical characteristics of neonatal fulminant necrotizing enterocolitis in a tertiary Children's hospital in the last 10 years
- Effects of neuromuscular electrical stimulation training on muscle size in collegiate track and field athletes
- Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communications
- Evaluation of four commercial tests for detecting ceftiofur in waste milk bulk tank samples
- A smart tele-cytology point-of-care platform for oral cancer screening
- Vasopressin SNP pain factors and stress in sickle cell disease
- Carbonate production of Micronesian reefs suppressed by thermal anomalies and Acanthaster as sea-level rises
- Microbial metabolisms in an abyssal ferromanganese crust from the Takuyo-Daigo Seamount as revealed by metagenomics
- Incidence of chronic kidney disease hospitalisations and mortality in Espírito Santo between 1996 to 2017
- The impact of short-term machine perfusion on the risk of cancer recurrence after rat liver transplantation with donors after circulatory death
- Proteomic profiling of the thrombin-activated canine platelet secretome (CAPS)
- Blood metal levels and serum testosterone concentrations in male and female children and adolescents: NHANES 2011–2012
- The effects of prolonged single night session of videogaming on sleep and declarative memory
- Diversity, distribution and dynamics of large trees across an old-growth lowland tropical rain forest landscape
- Mapping developmental QTL for plant height in soybean [Glycine max (L.) Merr.] using a four-way recombinant inbred line population
- Vaginal ring acceptability and related preferences among women in low- and middle-income countries: A systematic review and narrative synthesis
- UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal
- Positive selection and precipitation effects on the mitochondrial NADH dehydrogenase subunit 6 gene in brown hares (Lepus europaeus) under a phylogeographic perspective
- Evaluation of Minimum Inhibitory Concentrations for 154 Mycoplasma synoviae isolates from Italy collected during 2012-2017
- Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane
- Correction: Smoking, alcohol use disorder and tuberculosis treatment outcomes: A dual co-morbidity burden that cannot be ignored
- Correction: Effect of corruption on perceived difficulties in healthcare access in sub-Saharan Africa
- Knowledge-based best of breed approach for automated detection of clinical events based on German free text digital hospital discharge letters
- Importance of thorough tissue and cellular level characterization of targeted drugs in the evaluation of pharmacodynamic effects
- Integrated value-chain and risk assessment of Pig-Related Zoonoses in Ghana
- Failed sperm retrieval from severely oligospermic or non-obstructive azoospermic patients on oocyte retrieval day: Emergent oocyte cryopreservation is a feasible strategy
- Cassava yield traits predicted by genomic selection methods
- Verification of hub genes in the expression profile of aortic dissection
- Pig farmers’ willingness to pay for management strategies to reduce aggression between pigs
- Metabolomic response of Euglena gracilis and its bleached mutant strain to light
- Diagnostic value of ASVS for insulinoma localization: A systematic review and meta-analysis
- Newly educated care managers’ experiences of providing care for persons with stress-related mental disorders in the clinical primary care context
- Real-time telemetry monitoring of oxygen in the central complex of freely-walking Gromphadorhina portentosa
- Qualification programmes for immigrant health professionals: A systematic review
- An analytical model to minimize the latency in healthcare internet-of-things in fog computing environment
- Grain filling of early-season rice cultivars grown under mechanical transplanting
- Intercalation of small molecules into DNA in chromatin is primarily controlled by superhelical constraint
- Correlative evidence for co-regulation of phosphorus and carbon exchanges with symbiotic fungus in the arbuscular mycorrhizal Medicago truncatula
- How to design a dose-finding study on combined agents: Choice of design and development of R functions
- Altered expression of Notch1 in Alzheimer's disease
- The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American women
- Trunk velocity-dependent Light Touch reduces postural sway during standing
- Evaluation of cytological diagnostic accuracy for canine splenic neoplasms: An investigation in 78 cases using STARD guidelines
- Trade-offs in motivating volunteer effort: Experimental evidence on voluntary contributions to science
- Does caching strategy vary with microclimate in endangered Mt. Graham red squirrels?
- Assessment of energy expenditure during high intensity cycling and running using a heart rate and activity monitor in young active adults
- Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
- Implementation of a screening, brief intervention and referral to treatment programme for risky substance use in South African emergency centres: A mixed methods evaluation study
- Can the CalproQuest predict a positive Calprotectin test? A prospective diagnostic study
- The calcium sensor OsCBL1 modulates nitrate signaling to regulate seedling growth in rice
- Acceptability of and treatment preferences for recurrent bacterial vaginosis—Topical lactic acid gel or oral metronidazole antibiotic: Qualitative findings from the VITA trial
- Mathematical determination of the HIV-1 matrix shell structure and its impact on the biology of HIV-1
- Contingent negative variation during a modified cueing task in simulated driving
- CAMDI interacts with the human memory-associated protein KIBRA and regulates AMPAR cell surface expression and cognition
- Effect of feeding patterns on growth and nutritional status of children aged 0-24 months: A Chinese cohort study
- A fecal sequel: Testing the limits of a genetic assay for bat species identification
- Measuring the impact of chronic conditions and associated multimorbidity on health-related quality of life in the general population in Hong Kong SAR, China: A cross-sectional study
- Short and long-term clinical effectiveness and cost-effectiveness of a late-phase community-based balance and gait exercise program following hip fracture. The EVA-Hip Randomised Controlled Trial
- Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)
- Brazilian norms for the Bank of Standardized Stimuli (BOSS)
- Distinct varieties of aesthetic chills in response to multimedia
- Interaction between apolipoprotein E genotype and hypertension on cognitive function in older women in the Nurses’ Health Study
- Correction: Resistance profile of the HIV-1 maturation inhibitor GSK3532795 in vitro and in a clinical study
- New formulation of the Gompertz equation to describe the kinetics of untreated tumors
- Development of visual perception of others’ actions: Children’s judgment of lifted weight
- Retrospective comparative analysis of intraocular lens calculation formulas after hyperopic refractive surgery
- Human vitreous concentrations of citicoline following topical application of citicoline 2% ophthalmic solution
- Development and validation of exhaled breath condensate microRNAs to identify and endotype asthma in children
- Arthroscopic release for frozen shoulder: Does the timing of intervention and diabetes affect outcome?
- Risk factors affecting dairy cattle protective grouping behavior, commonly known as bunching, against Stomoxys calcitrans (L.) on California dairies
- Acceleration of chemical shift encoding-based water fat MRI for liver proton density fat fraction and T2* mapping using compressed sensing
- Characterisation and microbial community analysis of lipid utilising microorganisms for biogas formation
- Sexuality in male partners of women with fibromyalgia syndrome: A qualitative study
- Exploring optimization strategies for improving explicit water models: Rigid n-point model and polarizable model based on Drude oscillator
- Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camels
- Moving into an urban drug scene among people who use drugs in Vancouver, Canada: Latent class growth analysis
- Numerical study on the start and unstart phenomena in a scramjet inlet-isolator model
- Effects of dietary supplementation with apple peel powder on the growth, blood and liver parameters, and transcriptome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus)
- Urban growth simulation in different scenarios using the SLEUTH model: A case study of Hefei, East China
- Chronic bronchitis without airflow obstruction, asthma and rhinitis are differently associated with cardiovascular risk factors and diseases
- Factors associated with medication adherence among people with diabetes mellitus in poor urban areas of Cambodia: A cross-sectional study
- Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection status
- Force field generalization and the internal representation of motor learning
- Polyphenism of visual and chemical secondary sexually-selected wing traits in the butterfly Bicyclus anynana: How different is the intermediate phenotype?
- Minimal genetic differentiation of the malaria vector Nyssorhynchus darlingi associated with forest cover level in Amazonian Brazil
- The impact of leisure activities on older adults’ cognitive function, physical function, and mental health
- scafSLICR: A MATLAB-based slicing algorithm to enable 3D-printing of tissue engineering scaffolds with heterogeneous porous microarchitecture
- Association of serum leptin and adiponectin concentrations with echocardiographic parameters and pathophysiological states in patients with cardiovascular disease receiving cardiovascular surgery
- Operation of cognitive memory inhibition in adults with Down syndrome: Effects of maintenance load and material
- Influences on surgical antimicrobial prophylaxis decision making by surgical craft groups, anaesthetists, pharmacists and nurses in public and private hospitals
- Post-treatment Lyme disease symptoms score: Developing a new tool for research
- Expression of Concern: The Role of the RACK1 Ortholog Cpc2p in Modulating Pheromone-Induced Cell Cycle Arrest in Fission Yeast
- Equine bronchial fibroblasts enhance proliferation and differentiation of primary equine bronchial epithelial cells co-cultured under air-liquid interface
- Investigating cooperation with robotic peers
- Synthesis, purification and crystallization of a putative critical bulge of HAR1 RNA
- Prosthetic push-off power in trans-tibial amputee level ground walking: A systematic review
- A case study of the use of verbal reports for talent identification purposes in soccer: A Messi affair!
- Transgenerational deep sequencing revealed hypermethylation of hippocampal mGluR1 gene with altered mRNA expression of mGluR5 and mGluR3 associated with behavioral changes in Sprague Dawley rats with history of prolonged febrile seizure
- Obesity is associated with an impaired survival in lymphoma patients undergoing autologous stem cell transplantation
- Periodontal disease: Repercussions in pregnant woman and newborn health—A cohort study
- Origins of Chinese reindeer (Rangifer tarandus) based on mitochondrial DNA analyses
- Regional, racial, gender, and tumor biology disparities in breast cancer survival rates in Africa: A systematic review and meta-analysis
- How effective are films in inducing positive and negative emotional states? A meta-analysis
- 3D nanostructural characterisation of grain boundaries in atom probe data utilising machine learning methods
- An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factors
- Initial clinical radiological findings and staging to predict prognosis of primary hepatic angiosarcoma: A retrospective analysis
- A new early Eocene deperetellid tapiroid illuminates the origin of Deperetellidae and the pattern of premolar molarization in Perissodactyla
- Longevity and marginal bone loss of narrow-diameter implants supporting single crowns: A systematic review
- Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facility
- Cold-related Florida manatee mortality in relation to air and water temperatures
- Conceptual fluency in inductive reasoning
- Clinical outcomes and treatment patterns among Medicare patients with nonvalvular atrial fibrillation (NVAF) and chronic kidney disease
- Improvements in the learnability of smartphone haptic interfaces for visually impaired users
- Role of the malic enzyme in metabolism of the halotolerant methanotroph Methylotuvimicrobium alcaliphilum 20Z
- Cyclic loading test study on a new cast-in-situ insulated sandwich concrete wall
- Natural compounds as angiogenic enzyme thymidine phosphorylase inhibitors: In vitro biochemical inhibition, mechanistic, and in silico modeling studies
- Analysis of virulence potential of Escherichia coli O145 isolated from cattle feces and hide samples based on whole genome sequencing
- Pre-clinical medical student reflections on implicit bias: Implications for learning and teaching
- Prognostic significance of non-sustained ventricular tachycardia on stored electrograms in pacemaker recipients
- Determinants of preterm birth among mothers who gave birth at public hospitals in the Amhara region, Ethiopia: A case-control study
- Real-world evidence of the effectiveness of ombitasvir-paritaprevir/r ± dasabuvir ± ribavirin in patients monoinfected with chronic hepatitis C or coinfected with human immunodeficiency virus-1 in Spain
- Unique transcriptomic landscapes identified in idiopathic spontaneous and infection related preterm births compared to normal term births
- Restrained expansion of the recall germinal center response as biomarker of protection for influenza vaccination in mice
- Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth
- Achievement of weight loss in patients with overweight during dietetic treatment in primary health care
- Autophagy deficiency exacerbates colitis through excessive oxidative stress and MAPK signaling pathway activation
- The impacts of parity on lung function data (LFD) of healthy females aged 40 years and more issued from an upper middle income country (Algeria): A comparative study
- Reorganization of spatial configurations in visual working memory: A matter of set size?
- Unravelling travellers’ route choice behaviour at full-scale urban network by focusing on representative OD pairs in computer experiments
- Evaluating the higher-order structure of the Profile of Emotional Competence (PEC): Confirmatory factor analysis and Bayesian structural equation modeling
- HIV prevalence and correlated factors among male clients of female sex workers in a border region of China
- Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism(s) of pathogenesis and pathophysiology of pansteatitis
- Association between advanced maternal age and maternal and neonatal morbidity: A cross-sectional study on a Spanish population
- Ethnic differences in the prevalence, socioeconomic and health related risk factors of knee pain and osteoarthritis symptoms in older Malaysians
- Increasing knowledge of HIV status in a country with high HIV testing coverage: Results from the Botswana Combination Prevention Project
- Friends with benefits: The effects of vegetative shading on plant survival in a green roof environment
- Comparison of the fecal, cecal, and mucus microbiome in male and female mice after TNBS-induced colitis
- Identifying candidate diagnostic markers for early stage of non-small cell lung cancer
- Complex alternative splicing of human Endonuclease V mRNA, but evidence for only a single protein isoform
- Correction: KML001 Induces Apoptosis and Autophagic Cell Death in Prostate Cancer Cells via Oxidative Stress Pathway
- Unique developmental trajectories of risk behaviors in adolescence and associated outcomes in young adulthood
- Enhanced fibrinolysis detection in a natural occurring canine model with intracavitary effusions: Comparison and degree of agreement between thromboelastometry and FDPs, D-dimer and fibrinogen concentrations
- Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants
- Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stresses
- Autonomous drone hunter operating by deep learning and all-onboard computations in GPS-denied environments
- Heterogeneity Diffusion Imaging of gliomas: Initial experience and validation
- Frequency cluster formation and slow oscillations in neural populations with plasticity
- DHP23002 as a next generation oral paclitaxel formulation for pancreatic cancer therapy
- Diagnostic accuracy of SOX11 immunohistochemistry in mantle cell lymphoma: A meta-analysis
- Analytical solution to swing equations in power grids
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- Spatiotemporally random and diverse grid cell spike patterns contribute to the transformation of grid cell to place cell in a neural network model
- Empathic concern and personal distress depend on situational but not dispositional factors
- Who is more susceptible to job stressors and resources? Sensory-processing sensitivity as a personal resource and vulnerability factor
- Cost-effectiveness of integrating postpartum antiretroviral therapy and infant care into maternal & child health services in South Africa
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
- One step at a time: Physical activity is linked to positive interpretations of ambiguity
- Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cells
- Evaluation of various methods of selection of B. subtilis strains capable of secreting surface-active compounds
- Association between US Pharmacopeia (USP) monograph standards, generic entry and prescription drug costs
- Molecular characterisation of the synovial fluid microbiome in rheumatoid arthritis patients and healthy control subjects
- On sorption hysteresis in wood: Separating hysteresis in cell wall water and capillary water in the full moisture range
- Inbreeding, Allee effects and stochasticity might be sufficient to account for Neanderthal extinction
- Reliability and construct validity of the stepping-forward affordance perception test for fall risk assessment in community-dwelling older adults
- Socioeconomic determinants of nutritional status among ‘Baiga’ tribal children In Balaghat district of Madhya Pradesh: A qualitative study
- Study on characteristics of fire plume in building facade window under lateral blow
- ‘When you talk to someone in a bad way or always put her under pressure, it is actually worse than beating her’: Conceptions and experiences of emotional intimate partner violence in Rwanda and South Africa
- Effects of 6-mercaptopurine in pressure overload induced right heart failure
- The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomes
- Implementation and evaluation of an antimicrobial stewardship programme in companion animal clinics: A stepped-wedge design intervention study
- Factors associated with persistently high-cost health care utilization for musculoskeletal pain
- Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results
- Effect of repeated in vivo microCT imaging on the properties of the mouse tibia
- Coupling environment and physiology to predict effects of climate change on the taxonomic and functional diversity of fish assemblages in the Murray-Darling Basin, Australia
- Hematology and plasma biochemistries in the Blanding’s turtle (Emydoidea blandingii) in Lake County, Illinois
- CRISPR-Cas influences the acquisition of antibiotic resistance in Klebsiella pneumoniae
- Phosphorylation-dependent activity-based conformational changes in P21-activated kinase family members and screening of novel ATP competitive inhibitors
- Antidepressant prescriptions, discontinuation, depression and perinatal outcomes, including breastfeeding: A population cohort analysis
- Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative study
- Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysis
- Combined treatment (image-guided thrombectomy and endovascular therapy with open femoral access) for acute lower limb ischemia: Clinical efficacy and outcomes
- Low-latency single channel real-time neural spike sorting system based on template matching
- Quantifying the scale effect in geospatial big data using semi-variograms
- Paper-and-pencil versus computerized administration mode: Comparison of data quality and risk behavior prevalence estimates in the European school Survey Project on Alcohol and other Drugs (ESPAD)
- Regression adjusted colocalisation colour mapping (RACC): A novel biological visual analysis method for qualitative colocalisation analysis of 3D fluorescence micrographs
- Ostrich eggshell bead diameter in the Holocene: Regional variation with the spread of herding in eastern and southern Africa
- Spatial and temporal variations in female size at maturity of a Southern Rock Lobster (Jasus edwardsii) population: A likely response to climate change
- Inactive USP14 and inactive UCHL5 cause accumulation of distinct ubiquitinated proteins in mammalian cells
- Training rhesus macaques to take daily oral antiretroviral therapy for preclinical evaluation of HIV prevention and treatment strategies
- Left ventricular structural and functional changes in Friedreich ataxia – Relationship with body size, sex, age and genetic severity
- Magnitude and factors associated with anemia among pregnant women attending antenatal care in Bench Maji, Keffa and Sheka zones of public hospitals, Southwest, Ethiopia, 2018: A cross -sectional study
- Effectiveness of telerehabilitation in the management of adults with stroke: A systematic review
- Hydrogen sulphide-induced hypometabolism in human-sized porcine kidneys
- Correction: Comparison of the molecular properties of retinitis pigmentosa P23H and N15S amino acid replacements in rhodopsin
- Retraction: Regulation of gastric smooth muscle contraction via Ca2+-dependent and Ca2+-independent actin polymerization
- Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CT
- Blood type and breed-associated differences in cell marker expression on equine bone marrow-derived mesenchymal stem cells including major histocompatibility complex class II antigen expression
- Induced abortion and future use of IVF treatment; A nationwide register study
- Psychosocial determinants of sustained maternal functional impairment: Longitudinal findings from a pregnancy-birth cohort study in rural Pakistan
- Measurement of finger joint angle using stretchable carbon nanotube strain sensor
- Determinants of mortality among patients with drug-resistant tuberculosis in northern Nigeria
- Drugs modulating stochastic gene expression affect the erythroid differentiation process
- Efficacy of UB0316, a multi-strain probiotic formulation in patients with type 2 diabetes mellitus: A double blind, randomized, placebo controlled study
- Prognostic value of des-γ-carboxy prothrombin in patients with hepatocellular carcinoma treated with transarterial chemotherapy: A systematic review and meta-analysis
- Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis
- Antibiotic use in mandarin production (Citrus reticulata Blanco) in major mandarin-producing areas in Thailand: A survey assessment
- Application of CPI cutoff value based on parentage testing of duos and trios typed by four autosomal kits
- Correction: Good and Bad in the Hands of Politicians: Spontaneous Gestures during Positive and Negative Speech
- Adolescents with worse levels of oral health literacy have more cavitated carious lesions
- Effective methods for the inactivation of Francisella tularensis
- Detection of early-stage Alzheimer’s pathology using blood-based autoantibody biomarkers in elderly hip fracture repair patients
- Correlation between internal pudendal artery stenosis and erectile dysfunction in patients with suspected coronary artery disease
- Analysis of HER2 genomic binding in breast cancer cells identifies a global role in direct gene regulation
- Population productivity of shovelnose rays: Inferring the potential for recovery
- Correction: Long-term clinical outcomes in a cohort of patients with solitary plasmacytoma treated in the modern era
- Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitis
- Mineral absorption is an enriched pathway in a brain region of restless legs syndrome patients with reduced MEIS1 expression
- Changes in weight and body composition across five years at university: A prospective observational study
- Adeno-associated virus-mediated expression of human butyrylcholinesterase to treat organophosphate poisoning
- Effects of insulin signaling on mouse taste cell proliferation
- Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, Kenya
- TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technology
- Cost-effectiveness of QuantiFERON-TB Gold In-Tube versus tuberculin skin test for diagnosis and treatment of Latent Tuberculosis Infection in primary health care workers in Brazil
- Multifaceted intervention for the prevention and management of musculoskeletal pain in nursing staff: Results of a cluster randomized controlled trial
- Changes over time in creatinine clearance and comparison of emergent adverse events for HIV-positive adults receiving standard doses (300 mg/day) of lamivudine-containing antiretroviral therapy with baseline creatinine clearance of 30–49 vs ≥50 mL/min
- Population dynamics of foxes during restricted-area culling in Britain: Advancing understanding through state-space modelling of culling records
- Impacts of experimental advisory exit speed sign on traffic speeds for freeway exit ramp
- In-hospital outcomes and 30-day readmission rates among ischemic and hemorrhagic stroke patients with delirium
- Monitoring quality indicators for the Xpert MTB/RIF molecular assay in Ethiopia
- Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor for AAV-PHP.B capsids
- Correction: Using remote sensing to detect whale strandings in remote areas: The case of sei whales mass mortality in Chilean Patagonia
- Comparison of the inoculum size effects of antibiotics on IMP-6 β-lactamase-producing Enterobacteriaceae co-harboring plasmid-mediated quinolone resistance genes
- Contrast-enhanced computed tomography findings of canine primary renal tumors including renal cell carcinoma, lymphoma, and hemangiosarcoma
- Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720
- Overexpression of pink1 or parkin in indirect flight muscles promotes mitochondrial proteostasis and extends lifespan in Drosophila melanogaster
- Fiber stiffness, pore size and adhesion control migratory phenotype of MDA-MB-231 cells in collagen gels
- Comparison of two experimental ARDS models in pigs using electrical impedance tomography
- Are primary school children attending full-day school still engaged in sports clubs?
- Stroke risks in women with dysmenorrhea by age and stroke subtype
- Changes in patterns of mortality rates and years of life lost due to firearms in the United States, 1999 to 2016: A joinpoint analysis
- In vitro modeling of Batrachochytrium dendrobatidis infection of the amphibian skin
- Development and validation of LC-MS/MS method for imatinib and norimatinib monitoring by finger-prick DBS in gastrointestinal stromal tumor patients
- Correction: Habitat disturbance and the organization of bacterial communities in Neotropical hematophagous arthropods
- Characterisation of early metazoan secretion through associated signal peptidase complex subunits, prohormone convertases and carboxypeptidases of the marine sponge (Amphimedon queenslandica)
- Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adults
- Performance of patient acuity rating by rapid response team nurses for predicting short-term prognosis
- Changes in HbA1c during the first six years after the diagnosis of Type 2 diabetes mellitus predict long-term microvascular outcomes
- Correction: Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry
- Correction: Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Establishing an infrastructure for collaboration in primate cognition research
- Correction: The impact of public health insurance on health care utilisation, financial protection and health status in low- and middle-income countries: A systematic review
- Health provider and service-user experiences of sensory modulation rooms in an acute inpatient psychiatry setting
- Comparison of potential drug-drug interactions with metabolic syndrome medications detected by two databases
- The Polish version of the Cultural Intelligence Scale: Assessment of its reliability and validity among healthcare professionals and medical faculty students
- Selection of optimal reference genes for qRT-PCR analysis of shoot development and graviresponse in prostrate and erect chrysanthemums
- Metastasis risk prediction model in osteosarcoma using metabolic imaging phenotypes: A multivariable radiomics model
- Defining hospital community benefit activities using Delphi technique: A comparison between China and the United States
- Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1
- A robust multi-objective optimization framework to capture both cellular and intercellular properties in cardiac cellular model tuning: Analyzing different regions of membrane resistance profile in parameter fitting
- Sea star wasting disease demography and etiology in the brooding sea star Leptasterias spp.
- Diagnostic plasma miRNA-profiles for ovarian cancer in patients with pelvic mass
- Genetic diversity and drug resistance of HIV-1 among infected pregnant women newly diagnosed in Luanda, Angola
- I’ve been robbed! – Can changes in floral traits discourage bee pollination?
- Visualising statistical models using dynamic nomograms
- Assessing the capacity of Malawi’s district and central hospitals to manage traumatic diaphyseal femoral fractures in adults
- Diagnostic performance of basal cortisol level at 0900-1300h in adrenal insufficiency
- The Mastery Rubric for Bioinformatics: A tool to support design and evaluation of career-spanning education and training
- Microdissection and whole chromosome painting confirm karyotype transformation in cryptic species of the Lariophagus distinguendus (Förster, 1841) complex (Hymenoptera: Pteromalidae)
- Quality of Kangaroo Mother Care services in Ethiopia: Implications for policy and practice
- Gemcitabine potentiates the anti-tumour effect of radiation on medullary thyroid cancer
- iTRAQ-based high-throughput proteomics analysis reveals alterations of plasma proteins in patients infected with human bocavirus
- The detection of a non-anemophilous plant species using airborne eDNA
- Perception and control of low cable operation forces in voluntary closing body-powered upper-limb prostheses
- Neoadjuvant chemotherapy plus surgery versus concurrent chemoradiotherapy in stage IB2-IIB cervical cancer: A systematic review and meta-analysis
- Randomized methods to characterize large-scale vortical flow networks
- Disentangling the coexistence strategies of mud-daubing wasp species through trophic analysis in oases of Baja California peninsula
- Front-of-pack nutritional labels: Understanding by low- and middle-income Mexican consumers
- Distress in patients with end-stage renal disease: Staff perceptions of barriers to the identification of mild-moderate distress and the provision of emotional support
- Pathways to antibiotics in Bangladesh: A qualitative study investigating how and when households access medicine including antibiotics for humans or animals when they are ill
- DOC export is exceeded by C fixation in May Creek: A late-successional watershed of the Copper River Basin, Alaska
- Behavioral observation of prosocial behavior and social initiative is related to preschoolers’ psychopathological symptoms
- Evaluating the impact of citations of articles based on knowledge flow patterns hidden in the citations
- Correction: Economic sanctions and academia: Overlooked impact and long-term consequences
- Correction: A novel association between relaxin receptor polymorphism and hematopoietic stem cell yield after mobilization
- Expression of Concern: Cooperativity of Oncogenic K-Ras and Downregulated p16/INK4A in Human Pancreatic Tumorigenesis
- Price dispersion of generic medications
- Sex differences in body composition but not neuromuscular function following long-term, doxycycline-induced reduction in circulating levels of myostatin in mice
- The emotion regulation effect of cognitive control is related to depressive state through the mediation of rumination: An ERP study
- Comparison of SMS-EPI and 3D-EPI at 7T in an fMRI localizer study with matched spatiotemporal resolution and homogenized excitation profiles
- Left ventricular mass normalization for body size in children based on an allometrically adjusted ratio is as accurate as normalization based on the centile curves method
- Correction: Combining biophysical parameters, spectral indices and multivariate hyperspectral models for estimating yield and water productivity of spring wheat across different agronomic practices
- Correction: Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- 'Small small quarrels bring about happiness or love in the relationships’: Exploring community perceptions and gendered norms contributing to male perpetrated intimate partner violence in the Central Region of Ghana
- The performance of practitioners conducting facial comparisons on images of children across age
- Increased amounts and stability of telomeric repeat-containing RNA (TERRA) following DNA damage induced by etoposide
- Patients with limitation or withdrawal of life supporting care admitted in a medico-surgical intermediate care unit: Prevalence, description and outcome over a six-month period
- Correction: Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster
- Predicting the performance of TV series through textual and network analysis: The case of Big Bang Theory
- Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPD
- Mixed methods grant applications in the health sciences: An analysis of reviewer comments
- Renal abnormalities among children with sickle cell conditions in highly resource-limited setting in Ghana
- Size matters: How reaching and vergence movements are influenced by the familiar size of stereoscopically presented objects
- Willingness to receive institutional and community-based eldercare among the rural elderly in China
- An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
- Beyond executive functions, creativity skills benefit academic outcomes: Insights from Montessori education
- A LAMP assay for the rapid and robust assessment of Wolbachia infection in Aedes aegypti under field and laboratory conditions
- Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel disease
- Fiber-tract localized diffusion coefficients highlight patterns of white matter disruption induced by proximity to glioma
- The fight against polio through the NO-DO newsreels during the Francoism period in Spain
- Ocean sound levels in the northeast Pacific recorded from an autonomous underwater glider
- Cost-consequence analysis of influenza vaccination among the staff of a large teaching hospital in Rome, Italy: A pilot study
- The relationship among the progression of inflammation in umbilical cord, fetal inflammatory response, early-onset neonatal sepsis, and chorioamnionitis
- How medical professional students view older people with dementia: Implications for education and practice
- An enhanced nonparametric EWMA sign control chart using sequential mechanism
- Land use change, carbon stocks and tree species diversity in green spaces of a secondary city in Myanmar, Pyin Oo Lwin
- Is there a difference in women’s experiences of care with medication vs. manual vacuum aspiration abortions? Determinants of person-centered care for abortion services
- Maternal complications in pregnancy and childbirth for women with epilepsy: Time trends in a nationwide cohort
- Adsorption of oxytetracycline on kaolinite
- Interdisciplinary stratified care for low back pain: A qualitative study on the acceptability, potential facilitators and barriers to implementation
- The role of resource transfer in positive, non-additive litter decomposition
- The impact of language on the interpretation of resuscitation clinical care plans by doctors. A mixed methods study
- Quantum dots reveal heterogeneous membrane diffusivity and dynamic surface density polarization of dopamine transporter
- Genomic analysis of Shiga toxin-producing Escherichia coli from patients and asymptomatic food handlers in Japan
- The heavy metals lead and cadmium are cytotoxic to human bone osteoblasts via induction of redox stress
- Anatomical, taxonomic, and phylogenetic reappraisal of a poorly known ghost knifefish, Tembeassu marauna (Ostariophysi: Gymnotiformes), using X-ray microcomputed tomography
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry identification of Vibrio (Listonella) anguillarum isolated from sea bass and sea bream
- Recommendations of older adults on how to use the PROM ‘TOPICS-MDS’ in healthcare conversations: A Delphi study
- The winner takes it all—Competitiveness of single nodes in globalized supply networks
- Hamsters in the city: A study on the behaviour of a population of common hamsters (Cricetus cricetus) in urban environment
- Correction: Liquid biopsies for omics-based analysis in sentinel mussels
- Size matters! Association between journal size and longitudinal variability of the Journal Impact Factor
- Drug resistance and epidemiology characteristics of multidrug-resistant tuberculosis patients in 17 provinces of China
- A model-based framework for chronic hepatitis C prevalence estimation
- Adding rewards to regulation: The impacts of watershed conservation on land cover and household wellbeing in Moyobamba, Peru
- Clinical determinants of social media use in individuals with schizophrenia
- Arsenic and nutrient absorption characteristics and antioxidant response in different leaves of two ryegrass (Lolium perenne) species under arsenic stress
- An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in Malawi
- A single plasmid based CRISPR interference in Synechocystis 6803 – A proof of concept
- Structural vulnerability to narcotics-driven firearm violence: An ethnographic and epidemiological study of Philadelphia’s Puerto Rican inner-city
- Temporal trends in intracerebral hemorrhage: Evidence from the Austrian Stroke Unit Registry
- Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria
- Prediction of disease-related metabolites using bi-random walks
- Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey
- Biomarker discovery in inflammatory bowel diseases using network-based feature selection
- The Cinderella Complex: Word embeddings reveal gender stereotypes in movies and books
- Exoproteome profiling of Trypanosoma cruzi during amastigogenesis early stages
- Reproducible phenotype alteration due to prolonged cooling of the pupae of Polyommatus icarus butterflies
- Nutritional treatment with an immune-modulating enteral formula alleviates 5-fluorouracil-induced adverse effects in rats
- Pharmacy-based predictors of non-adherence, non-persistence and reinitiation of antihypertensive drugs among patients on oral diabetes drugs in the Netherlands
- Systematic review of the accuracy of plasma preparation tubes for HIV viral load testing
- Circadian clock regulates the shape and content of dendritic spines in mouse barrel cortex
- “Anybody can make kids; it takes a real man to look after your kids”: Aboriginal men’s discourse on parenting
- Correction: A 1D computer model of the arterial circulation in horses: An important resource for studying global interactions between heart and vessels under normal and pathological conditions
- Maternal interpregnancy weight change and premature birth: Findings from an English population-based cohort study
- Correction: Identifying performance benchmarks and determinants for reproductive performance and calf survival using a longitudinal field study of cow-calf herds in western Canada
- Prognostic value of the model for end-stage liver disease excluding INR score (MELD-XI) in patients with adult congenital heart disease
- Treatment of Urethral Pain Syndrome (UPS) in Sweden
- Migration and political polarization in the U.S.: An analysis of the county-level migration network
- Epidemiology and complications of late-onset sepsis: an Italian area-based study
- The relationship between women’s experience of intimate partner violence and other socio-demographic factors, and under-5 children’s health in South Africa
- Association between trunk and gluteus muscle size and long jump performance
- Multimorbidity and complex multimorbidity in Brazilian rural workers
- Correction: Interspecific Phylogenic Relationships within Genus Melilotus Based on Nuclear and Chloroplast DNA
- Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions
- Wolf diet and prey selection in the South-Eastern Carpathian Mountains, Romania
- In vitro activity of aryl-thiazole derivatives against Schistosoma mansoni schistosomula and adult worms
- Sample size issues in multilevel logistic regression models
- Seed germination ecology of Ageratum houstonianum: A major invasive weed in Nepal
- Experiences of lifestyle change among women with gestational diabetes mellitus (GDM): A behavioural diagnosis using the COM-B model in a low-income setting
- Pharmacologic management of HCV treatment in patients with HCV monoinfection vs. HIV/HCV coinfection: Does coinfection really matter?
- The association between cigarette smoking and serum thyroid stimulating hormone, thyroid peroxidase antibodies and thyroglobulin antibodies levels in Chinese residents: A cross-sectional study in 10 cities
- Mouse movement measures enhance the stop-signal task in adult ADHD assessment
- Ecosystem functioning in urban grasslands: The role of biodiversity, plant invasions and urbanization
- Correction: KETOS: Clinical decision support and machine learning as a service – A training and deployment platform based on Docker, OMOP-CDM, and FHIR Web Services
- Does craniofacial morphology affect third molars impaction? Results from a population-based study in northeastern Germany
- Hyperconnectivity during screen-based stories listening is associated with lower narrative comprehension in preschool children exposed to screens vs dialogic reading: An EEG study
- Weight loss is associated with improved quality of life among rural women completers of a web-based lifestyle intervention
- Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening
- Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile
- Golgi reassembly and stacking protein 65 downregulation is required for the anti-cancer effect of dihydromyricetin on human ovarian cancer cells
- SSR marker development in Clerodendrum trichotomum using transcriptome sequencing
- Risk factors for the carriage of Streptococcus infantarius subspecies infantarius isolated from African fermented dairy products
- Development of an intervention tool for precision oral self-care: Personalized and evidence-based practice for patients with periodontal disease
- Personal values in adolescence and psychological distress in adults: A cross-sectional study based on a retrospective recall
- Overactive bladder and bladder pain syndrome/interstitial cystitis in primary Sjögren’s syndrome patients: A nationwide population-based study
- Clinical utility of combined preimplantation genetic testing methods in couples at risk of passing on beta thalassemia/hemoglobin E disease: A retrospective review from a single center
- Hip stress distribution - Predictor of dislocation in hip arthroplasties. A retrospective study of 149 arthroplasties
- Mortality, morbidity, and cardiac surgery in Injection Drug Use (IDU)-associated versus non-IDU infective endocarditis: The need to expand substance use disorder treatment and harm reduction services
- Pup mortality in New Zealand sea lions (Phocarctos hookeri) at Enderby Island, Auckland Islands, 2013-18
- In vitro endothelial cell migration from limbal edge-modified Quarter-DMEK grafts
- Liquid Chromatography/Mass Spectrometry based serum metabolomics study on recurrent abortion women with antiphospholipid syndrome
- Gut carriage of antimicrobial resistance genes among young children in urban Maputo, Mozambique: Associations with enteric pathogen carriage and environmental risk factors
- Prepubertal nutrition alters Leydig cell functional capacity and timing of puberty
- Reliability of the Swedish version of the Evidence-Based Practice Attitude Scale assessing physiotherapist’s attitudes to implementation of evidence-based practice
- Mitochondrial alarmins are tissue mediators of ventilator-induced lung injury and ARDS
- Complete Chloroplast Genomes of Vachellia nilotica and Senegalia senegal: Comparative Genomics and Phylogenomic Placement in a New Generic System
- Retraction: Over-Expression of Superoxide Dismutase Ameliorates Cr(VI) Induced Adverse Effects via Modulating Cellular Immune System of Drosophila melanogaster
- Effect of pre-season training phase on anthropometric, hormonal and fitness parameters in young soccer players
- Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis
- Outcome of patients with heart failure after transcatheter aortic valve implantation
- Fatty acid profile of Romanian’s common bean (Phaseolus vulgaris L.) lipid fractions and their complexation ability by β-cyclodextrin
- Appropriate empirical antibiotic therapy and mortality: Conflicting data explained by residual confounding
- Treatment of corneal endothelial damage in a rabbit model with a bioengineered graft using human decellularized corneal lamina and cultured human corneal endothelium
- Telbivudine on IgG-associated hypergammaglobulinemia and TGF-β1 hyperactivity in hepatitis B virus-related liver cirrhosis
- Correction: Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- Correction: Mobile health-based physical activity intervention for individuals with spinal cord injury in the community: A pilot study
- Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage
- Correction: Use of IoT sensing and occupant surveys for determining the resilience of buildings to forest fire generated PM2.5
- Correction: The modulation of facial mimicry by attachment tendencies and their underlying affiliation motives in 3-year-olds: An EMG study
- Correction: Cognitive impairment in multiple sclerosis: An exploratory analysis of environmental and lifestyle risk factors
- Discovering novel disease comorbidities using electronic medical records
- Glutathione contributes to efficient post-Golgi trafficking of incoming HPV16 genome
- Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics
- Social information use in adolescents: The impact of adults, peers and household composition
- Public practices on antibiotic use: A cross-sectional study among Qatar University students and their family members
- Effects of Topper Training on psychosocial problems, self-esteem, and peer victimisation in Dutch children: A randomised trial
- Comparative studies of two generations of NanoString nCounter System
- General practitioners’ perceptions of delayed antibiotic prescription for respiratory tract infections: A phenomenographic study
- Can altered magnetic field affect the foraging behaviour of ants?
- Parasitic infections and medical expenses according to Health Insurance Review Assessment claims data in South Korea, 2011–2018
- A prospective observational study of on-treatment plasma homocysteine levels as a biomarker of toxicity, depression and vitamin supplementation lead-in time pre pemetrexed, in patients with non-small cell lung cancer and malignant mesothelioma
- A strategy to identify protein-N-myristoylation-dependent phosphorylation reactions of cellular proteins by using Phos-tag SDS-PAGE
- Expression profile of sonic hedgehog signaling-related molecules in basal cell carcinoma
- Seasonal alternation of the ontogenetic development of the moon jellyfish Aurelia coerulea in Maizuru Bay, Japan
- Reliability of measurement of active trunk movement in wheelchair basketball players
- Chinese SLE Treatment and Research group (CSTAR) registry: Clinical significance of thrombocytopenia in Chinese patients with systemic lupus erythematosus
- Does source credibility matter for point-of-decision prompts? A quasi-experimental field study to increase stair use
- Male-pattern baldness and incident coronary heart disease and risk factors in the Heinz Nixdorf Recall Study
- Quality and utilization patterns of maternity waiting homes at referral facilities in rural Zambia: A mixed-methods multiple case analysis of intervention and standard of care sites
- Determining an optimal pool size for testing beef herds for Johne’s disease in Australia
- Correction: Change in larval fish assemblage in a USA east coast estuary estimated from twenty-six years of fixed weekly sampling
- APOE-knockout in rabbits causes loss of cells in nucleus pulposus and enhances the levels of inflammatory catabolic cytokines damaging the intervertebral disc matrix
- Testing Species Assignments in Extant Terebratulide Brachiopods: A Three-dimensional Geometric Morphometric Analysis of Long-Looped Brachidia
- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Improved chemotherapy modeling with RAG-based immune deficient mice
- Effect of tracheal antimicrobial peptide on the development of Mannheimia haemolytica pneumonia in cattle
- The internal realities of individuals with type 2 diabetes – a functional framework of self-management practices via Grounded Theory approach
- Role of platelet parameters in early detection and prediction of severity of preeclampsia: A comparative cross-sectional study at Ayder comprehensive specialized and Mekelle general hospitals, Mekelle, Tigray, Ethiopia
- eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy
- Smoking and other determinants of bone turnover
- Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypass
- School engagement of children in early grades: Psychometric, and gender comparisons
- Correction: A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Perceived attractiveness of Czech faces across 10 cultures: Associations with sexual shape dimorphism, averageness, fluctuating asymmetry, and eye color
- Discovery of stable and prognostic CT-based radiomic features independent of contrast administration and dimensionality in oesophageal cancer
- Correction: Population-based dementia prediction model using Korean public health examination data: A cohort study
- Location, location, location: Close ties among older continuing care retirement community residents
- Correction: ISED: Constructing a high-resolution elevation road dataset from massive, low-quality in-situ observations derived from geosocial fitness tracking data
- Correction: Use of validated objective methods of locomotion characteristics and weight distribution for evaluating the efficacy of ketoprofen for alleviating pain in cows with limb pathologies
- Monitoring fine root growth to identify optimal fertilization timing in a forest plantation: A case study in Northeast Vietnam
- Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperatures
- Enterovirus 71 vaccine acceptance among parents of children < 5 years old and their knowledge of hand, foot and mouth disease, Chongqing, China, 2017
- Correction: Transcriptome profiling of mouse brain and lung under Dip2a regulation using RNA-sequencing
- Genetic diversity and antiretroviral resistance-associated mutation profile of treated and naive HIV-1 infected patients from the Northwest and Southwest regions of Cameroon
- Maximum parsimony interpretation of chromatin capture experiments
- Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Incidence and characteristics of ventricular tachycardia in patients after percutaneous coronary revascularization of chronic total occlusions
- Estimating measures of latent variables from m-alternative forced choice responses
- Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
- First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from Croatia
- The inhibitory effects of polypyrrole on the biofilm formation of Streptococcus mutans
- Self-reported adverse drug effects and associated factors among H. pylori infected patients on standard triple therapy: Prospective follow up study
- Upregulation of ERK phosphorylation in rat dorsal root ganglion neurons contributes to oxaliplatin-induced chronic neuropathic pain
- Characterization of the relationship between neutron production and thermal load on a target material in an accelerator-based boron neutron capture therapy system employing a solid-state Li target
- Remote heart rate monitoring - Assessment of the Facereader rPPg by Noldus
- Seroprevalence of rubella virus antibodies among pregnant women in the Center and South-West regions of Cameroon
- Effectiveness of steam sterilization of reusable medical devices in primary and secondary care public hospitals in Nepal and factors associated with ineffective sterilization: A nation-wide cross-sectional study
- Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina
- Ritualized aggressive behavior reveals distinct social structures in native and introduced range tawny crazy ants
- The value of kinetic glomerular filtration rate estimation on medication dosing in acute kidney injury
- Screening and characterization of long noncoding RNAs involved in the albinism of Ananas comosus var. bracteatus leaves
- Visual attention to emotional faces in adolescents with social anxiety disorder receiving cognitive behavioral therapy
- A Q fever outbreak associated to courier transport of pets
- Antibodies against measles and rubella virus among different age groups in Thailand: A population-based serological survey
- Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific
- Correction: The relationship between context, structure, and processes with outcomes of 6 regional diabetes networks in Europe
- Correction: The C-reactive protein/albumin ratio as an independent predictor of mortality in patients with severe sepsis or septic shock treated with early goal-directed therapy
- Interleukin 21 (IL-21) regulates chronic allograft vasculopathy (CAV) in murine heart allograft rejection
- Semantic computational analysis of anticoagulation use in atrial fibrillation from real world data
- The implementation of HTA in medicine pricing and reimbursement policies in Indonesia: Insights from multiple stakeholders
- International experiences during United States ophthalmology residency training: Current structure of international experiences and perspectives of faculty mentors at United States training institutions
- Questionable utility of digoxin in left-ventricular assist device recipients: A multicenter, retrospective analysis
- Genotyping and outcomes of presumptive second line ART failure cases switched to third line or maintained on second line ART in Mumbai, India
- A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failure
- Airway microbiome composition correlates with lung function and arterial stiffness in an age-dependent manner
- An odorant receptor from Anopheles gambiae that demonstrates enantioselectivity to the plant volatile, linalool
- Factors associated with full immunization of children 12–23 months of age in Ethiopia: A multilevel analysis using 2016 Ethiopia Demographic and Health Survey
- Additional evidence that the rat renal interstitium contracts in vivo
- Factors affecting acceptance of at-birth point of care HIV testing among providers and parents in Kenya: A qualitative study
- Removal efficiency of central vacuum system and protective masks to suspended particles from dental treatment
- Psychological well-being and distress in patients with generalized anxiety disorder: The roles of positive and negative functioning
- Conventional rotator cuff versus all-suture anchors—A biomechanical study focusing on the insertion angle in an unlimited cyclic model
- Are viral-infections associated with Ménière’s Disease? A systematic review and meta-analysis of molecular-markers of viral-infection in case-controlled observational studies of MD
- An evaluation of genetic causes and environmental risks for bilateral optic atrophy
- Comparative vector competence of the Afrotropical soft tick Ornithodoros moubata and Palearctic species, O. erraticus and O. verrucosus, for African swine fever virus strains circulating in Eurasia
- Effects of the solubility of yeast cell wall preparations on their potential prebiotic properties in dogs
- Carbogen gas-challenge BOLD fMRI in assessment of liver hypoxia after portal microcapsules implantation
- Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic review
- Development of an easy-to-use questionnaire assessing critical care nursing competence in Japan: A cross-sectional study
- Towards successful business process improvement – An extension of change acceleration process model
- Correction: Dietary polyphenols as a safe and novel intervention for modulating pain associated with intervertebral disc degeneration in an in-vivo rat model
- Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria
- Correction: Relationship between self-disclosure to first acquaintances and subjective well-being in people with schizophrenia spectrum disorders living in the community
- Impact of ATM rs1801516 on late skin reactions of radiotherapy for breast cancer: Evidences from a cohort study and a trial sequential meta-analysis
- Involvement of human and canine MRP1 and MRP4 in benzylpenicillin transport
- Soil organic matter rather than ectomycorrhizal diversity is related to urban tree health
- Clinical risk assessment in early pregnancy for preeclampsia in nulliparous women: A population based cohort study
- The relation between circulating levels of vitamin D and parathyroid hormone in children and adolescents with overweight or obesity: Quest for a threshold
- Behavioural evidence for segments as subordinate units in Chinese spoken word production: The form-preparation paradigm revisited
- Correction: Measuring the impact of an interdisciplinary learning project on nursing, architecture and landscape design students’ empathy
- Analysis of the characteristics of chemotherapy-resistant renal cell carcinomas based on global transcriptional analysis of their tissues and cell lines
- The characteristics and treatment patterns of patients with Parkinson’s disease in the United States and United Kingdom: A retrospective cohort study
- Sex differences in youth elite swimming
- Unconventional SCCmec types and low prevalence of the Panton-Valentine Leukocidin exotoxin in South African blood culture Staphylococcus aureus surveillance isolates, 2013-2016
- Prosocial perceptions of taxation predict support for taxes
- Correction: Clonality analysis of pulmonary tumors by genome-wide copy number profiling
- Improved oxygenation following methylprednisolone therapy and survival in paediatric acute respiratory distress syndrome
- Normative values for relative schoolbag weight in primary school children aged 6-14 from Czech Republic: A pilot study
- Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylase
- Correction: SNV discovery and functional candidate gene identification for milk composition based on whole genome resequencing of Holstein bulls with extremely high and low breeding values
- Monoclonal antibody anti-PBP2a protects mice against MRSA (methicillin-resistant Staphylococcus aureus) infections
- Diurnal variations of amplitude of accommodation in different age groups
- HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancer
- Infusion of HIV-1 Nef-expressing astrocytes into the rat hippocampus induces enteropathy and interstitial pneumonitis and increases blood–brain-barrier permeability
- Correlation analysis of cold-related gene expression with physiological and biochemical indicators under cold stress in oil palm
- Student engagement and wellbeing over time at a higher education institution
- Gender-based differences in platelet function and platelet reactivity to P2Y12 inhibitors
- Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
- Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
- Differential phosphorylation determines the repressor and activator potencies of GLI1 proteins and their efficiency in modulating the HPV life cycle
- Polymorphisms of FDPS, LRP5, SOST and VKORC1 genes and their relation with osteoporosis in postmenopausal Romanian women
- Depression increases the risk of rotator cuff tear and rotator cuff repair surgery: A nationwide population-based study
- Interleukin-38 interacts with destrin/actin-depolymerizing factor in human keratinocytes
- Correction: Fast, quantitative, murine cardiac 19F MRI/MRS of PFCE-labeled progenitor stem cells and macrophages at 9.4T
- Persistent post-discharge opioid prescribing after traumatic brain injury requiring intensive care unit admission: A cross-sectional study with longitudinal outcome
- Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
- Aerobic exercise increases post-exercise exogenous protein oxidation in healthy young males
- Selection for tandem stop codons in ciliate species with reassigned stop codons
- Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretations
- Correction: Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Correction: People making deontological judgments in the Trapdoor dilemma are perceived to be more prosocial in economic games than they actually are
- LFRET, a novel rapid assay for anti-tissue transglutaminase antibody detection
- Effects of isotemporal substitution of sedentary behavior with light-intensity or moderate-to-vigorous physical activity on cardiometabolic markers in male adolescents
- Topical estrogen application to wounds promotes delayed cutaneous wound healing in 80-week-old female mice
- Correction: An international randomised placebo-controlled trial of a four-component combination pill (“polypill”) in people with raised cardiovascular risk
- Correction: Evaluation of lung toxicity risk with computed tomography ventilation image for thoracic cancer patients
- Retraction: Pathological Roles of Interleukin-22 in the Development of Recurrent Hepatitis C after Liver Transplantation
- Correction: Elevational Distribution and Ecology of Small Mammals on Tanzania's Second Highest Mountain
- Correction: Decreased breast cancer-specific mortality risk in patients with a history of thyroid cancer
- Correction: Fecal microbiota dysbiosis in macaques and humans within a shared environment
- Correction: The center of pressure and ankle muscle co-contraction in response to anterior-posterior perturbations
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání