A Novel Recessive Mutation in SPEG Causes Early Onset Dilated Cardiomyopathy
Authors:
Aviva Levitas aff001; Emad Muhammad aff002; Yuan Zhang aff004; Isaac Perea Gil aff004; Ricardo Serrano aff005; Nashielli Diaz aff004; Maram Arafat aff002; Alexandra A. Gavidia aff004; Michael S. Kapiloff aff005; Mark Mercola aff005; Yoram Etzion aff006; Ruti Parvari aff002; Ioannis Karakikes aff004; Ricardo Serrano aff006; Michael S. Kapiloff aff007; Mark Mercola aff006; Yoram Etzion aff008
Authors place of work:
Department of Pediatric Cardiology, Soroka University Medical Center and Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff001; The Shraga Segal Department of Microbiology, Immunology & Genetics, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff002; The National Institute for Biotechnology in the Negev, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff003; Department of Cardiothoracic Surgery, Stanford University School of Medicine, Stanford, California, United States of America
aff004; Cardiovascular Institute, Stanford University School of Medicine, Stanford, California, United States of America
aff005; Regenerative Medicine & Stem Cell Research Center, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff006; Cardiovascular Institute and Department of Medicine, Stanford University, Stanford, CA, USA
aff006; Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff007; Cardiovascular Institute and Departments of Ophthalmology and Medicine, Stanford University, Stanford, CA, USA
aff007; Regenerative Medicine & Stem Cell Research Center, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff008; Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel
aff009
Published in the journal:
A Novel Recessive Mutation in SPEG Causes Early Onset Dilated Cardiomyopathy. PLoS Genet 16(9): e32767. doi:10.1371/journal.pgen.1009000
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1009000
Summary
Dilated cardiomyopathy (DCM) is a common cause of heart failure and sudden cardiac death. It has been estimated that up to half of DCM cases are hereditary. Mutations in more than 50 genes, primarily autosomal dominant, have been reported. Although rare, recessive mutations are thought to contribute considerably to DCM, especially in young children. Here we identified a novel recessive mutation in the striated muscle enriched protein kinase (SPEG, p. E1680K) gene in a family with nonsyndromic, early onset DCM. To ascertain the pathogenicity of this mutation, we generated SPEG E1680K homozygous mutant human induced pluripotent stem cell derived cardiomyocytes (iPSC-CMs) using CRISPR/Cas9-mediated genome editing. Functional studies in mutant iPSC-CMs showed aberrant calcium homeostasis, impaired contractility, and sarcomeric disorganization, recapitulating the hallmarks of DCM. By combining genetic analysis with human iPSCs, genome editing, and functional assays, we identified SPEG E1680K as a novel mutation associated with early onset DCM and provide evidence for its pathogenicity in vitro. Our study provides a conceptual paradigm for establishing genotype-phenotype associations in DCM with autosomal recessive inheritance.
Keywords:
Gene expression – Cardiomyocytes – Sarcomeres – Pathogenesis – CRISPR – Homozygosity – Bone and mineral metabolism – Human genomics – Induced pluripotent stem cells
Introduction
Dilated cardiomyopathy (DCM) is a complex disorder with a prevalence of 1 in 250–400 individuals and a leading cause of heart failure [1]. Characterized by left ventricular dilation and systolic dysfunction, DCM is the most common form of cardiomyopathy and cause of heart transplantation in both adults and children [2]. Familial DCM, now more commonly diagnosed, accounts for up to half of reported cases [3]. In the past two decades, the realization of the significance of a familial link in DCM has led to the discovery of a plethora of mutations in genes encoding proteins involved in various functions of the myocardium. To date, at least 50 genes have been implicated in DCM causation or risk, including genes encoding cytoskeletal, sarcolemma, mitochondrial, calcium cycling, costamere, and sarcomere proteins [1,4].
While these discoveries have provided invaluable insights, our understanding of the genetic basis of familial DCM remains incomplete. First, the genetics of DCM are characterized by locus and allelic heterogeneity, with most mutations being rare or even unique ('private') [5]. Given the low frequency and locus and allelic heterogeneity, attempts to validate the pathogenicity of putative disease-causing gene variants in a small number of probands or families have proven challenging. Second, the hitherto reported mutations explain only a fraction of familial DCM [6], primarily those exhibiting autosomal dominant inheritance [7]. Meanwhile, autosomal recessive inheritance has been implicated in pediatric DCM [7–9]. Finally, the growing number of gene variants linked to DCM, combined with insufficient evidence of the pathogenicity of each mutation presents a dilemma at the bedside, complicating the diagnosis and treatment of symptomatic patients and the management of asymptomatic relatives [7,10,11].
The recent advent of innovative technologies, such as human induced pluripotent stem cells (iPSCs) [12] and CRISPR/Cas9-based genome editing [13], and an increasingly refined capacity to differentiate iPSCs into cardiomyocytes (iPSC-CMs) [14] provide an opportunity for the generation of human patient-specific cells for disease modeling. Human iPSC-CMs exhibit fetal-like phenotypes, which are often seen as a drawback for modeling late onset diseases [15]. Despite this immaturity, iPSC-CMs represent a suitable model for studying monogenic diseases that manifest phenotypes during fetal or early postnatal stages of development, such as those observed in the family in our study.
In this study, we report a novel autosomal recessive variant (p. E1680K) in striated muscle enriched protein kinase (SPEG) causing early onset DCM. Combining iPSC and CRISPR/Cas9-mediated genome engineering technologies, we established an in vitro model to ascertain the pathogenicity of this mutation. Functional analysis showed that iPSC-CMs carrying the homozygous SPEG E1680K mutation recapitulated the hallmarks of DCM, including aberrant calcium homeostasis, impaired contractility, and sarcomeric disarray. These observations suggest SPEG E1680K as a novel DCM-causing mutation. Our study is the first to report SPEG E1680K as a human genetic variant and to validate its pathogenicity in recessive, early-onset DCM. We provide a proof-of-concept that in vitro iPSC models could effectively validate the pathogenicity of novel genetic variants associated with recessively inherited DCM that are otherwise poorly supported by few probands and families.
Materials and methods
Derivation of human induced pluripotent stem cells
All protocols for this study were approved by the Stanford University Institutional Review Board. Peripheral blood mononuclear cells (PBMCs) were obtained by conducting a standard blood draw from consenting individuals and isolated using a Ficoll gradient separation. PBMCs were reprogrammed using a Sendai virus vector expressing OCT4, KLF4, SOX2, and MYC (OKSM) (Life Technologies) following the protocol supplied by the manufacturer. Approximately one month after reprogramming, iPSC clones were isolated and cultivated on growth factor-reduced Matrigel (Corning)-coated 6-well tissue culture dishes (Greiner) in E8 pluripotent stem cell culture medium (Life Technologies).
Chemically-defined differentiation of human iPSC-CMs
The iPSCs were differentiated into iPSC-CMs using a small molecule-mediated protocol [16]. Briefly, iPSCs were cultured in RPMI 1640 medium supplemented with 1x B27 minus insulin supplement (Thermo Fisher Scientific) and the small molecule CHIR99021 (6 μM) for 48 hours. The media was then switched to RPMI 1640 medium supplemented with 1x B27 minus insulin supplement and the small molecule IWR-1 (3 μM) for another 48h. Twelve days after cardiac differentiation, iPSC-CMs were enriched with RPMI-1640 without glucose (Life Technologies) supplemented with 1x B27 minus insulin and 5 mM sodium DL-lactate (Sigma) for 96h. Beating iPSC-CMs were maintained in RPMI 1640 medium supplemented with 1x B27 supplement (Thermo Fisher Scientific). Dissociation of iPSC-CMs was performed using pre-warmed TrypLE select 10x (Thermo Fisher Scientific) at 37°C for 10min. After detaching, cells were collected by centrifugation (100g, 5 min), resuspended in RPMI 1640 with 1x B27 media, and plated in Matrigel-coated dishes. All experiments were performed with iPSC-CMs at forty-five to sixty days post differentiation.
CRISPR/Cas9-mediated genome editing
A guide RNA targeting the SPEG locus was designed using a web-based tool (crispr.mit.edu/) and chosen based on a high on-target score and the lowest off-target score. The guide sequence was cloned into the single guide RNA (sgRNA) scaffold of the BsbI-digested pSpCas9(BB)-2A-GFP vector (PX458, a gift from Feng Zhang; Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID:Addgene_48138) using a pair of annealed oligos. Genome editing was performed by co-transfection of iPSCs with the CRISPR/Cas9/gRNA vector (1 μg) and homology-directed repair (HDR) single-stranded oligo DNA nucleotides (ssODN) (4 μg) using the Lipofectamine Stem Reagent (Thermo Fisher Scientific). Twenty-four hours after transfection, cells were dissociated into single cells using TrypLE Express (Thermo Fisher Scientific) and sorted by flow cytometry for GFP expression. The GFP positive cells were seeded at a density of 1,000 cells per well in a Matrigel-coated 6-well plate for single cell clone expansion. Seven to ten days after seeding, individual clones were manually picked into a 96-well plate. A small proportion of the cells were used for DNA extraction with QuickExtract solution (Epicenter), followed by PCR using the PrimeSTAR GXL DNA Polymerase (Takara) and site-specific primers (Forward: cccatagaaagtgggagttcaag; Reverse: actctgctgcctacctaaca). Primers and oligos were synthesized at Integrated DNA Technologies (IDT). We isolated isogenic clones from the targeted parental iPSC line: an unedited control (referred to as SPEGWT) clone and a genome-edited homozygous (referred to as SPEGMUT) clone.
gRNA: tctgggatgtagctgcacagagg;
HDRssODN:gtgctgagctgggacctgccctgagcgctgggctgggccgggcagttggcactgggcactgttctccttgatctgggatgtagctgcacagaggagctgctggagcgaatcgccaggaaacccaccg.
Off-target detection
Genomic DNA was extracted from the parental and the gene-edited iPSCs using the DNeasy Blood & Tissue Kit (Qiagen). Primers were designed to amplify regions corresponding to the top ranking in silico predicted off-target sites using the bioinformatics tool COSMID. The top 10 targets were selected, and putative off-target sites were amplified by PCR using 1.25 units of PrimeSTAR GXL DNA Polymerase (Clontech), 50 ng of genomic DNA, and 0.4 μM of forward primer and 0.4μM of reverse primer in a total volume of 25 μl per reaction. The PCR amplicons were sequenced by the Sanger method. Primer sequences are shown in S1 Table.
Immunocytochemistry
For pluripotency marker analysis, human iPSC colonies grown in Matrigel-coated 8-well chamber glasses (Thermo Scientific) were fixed using 4% paraformaldehyde (PFA) for 10 min at room temperature. Cells were permeabilized with 0.5% Triton X-100 followed by blocking with 5% goat serum in PBS with 0.1% Tween 20. The cells were incubated with mouse anti-SSEA4 (R&D systems), rabbit anti-OCT3/4 (Santa Cruz Biotechnology), or mouse anti-SOX2 (R&D systems) primary antibodies overnight, washed and then incubated with Alexa Fluor-conjugated secondary antibodies (Life Technologies) for 1 h at room temperature. Finally, the cells were counterstained with DAPI (Life Technologies) and mounted with anti-fade medium (DAKO). For sarcomere protein visualization, primary antibodies include rabbit polyclonal anti-cardiac troponin T (Abcam) and mouse monoclonal anti-sarcomeric alpha-actinin (Sigma-Aldrich). Epifluorescence Images were acquired using an Eclipse 80i microscope (Nikon Instruments). High resolution images were acquired using a Zeiss LSM 880 confocal system with airyscan imaging mode, followed by airyscan processing using Zeiss Zen software (Zeiss).
Sarcomere length and sarcomere packing density
The length of the sarcomeres and their spatial organization were calculated based on the ‘sarcomere packing density’ concept [17], which was implemented in a custom MATLAB script (Mathworks). Briefly, we defined a square region of 200x200 pixels in each image of well-defined iPSC-CMs immunostained for alpha-actinin and calculated the 2D Fourier power spectrum. Next, we selected a 30-degree angular portion of the 2D spectrum centered along the preferential orientation of the sarcomeres. The selected points are used to obtain the 1D profile of the power spectrum. In the presence of well-organized sarcomeres, this 1D profile exhibits an exponentially decaying signal with periodic peaks centered at multiples of the spatial frequency of the sarcomeres (f0). The 1D power spectrum can be approximated as:
The custom MATLAB script is provided in the Supplementary Information (Supplementary note).
Whole exome sequencing
Genomic DNA was extracted from peripheral blood and submitted to Otogenetics Corporation (Norcross, GA USA) for exome capture and sequencing. Briefly, genomic DNA was subjected to agarose gel and OD ratio tests to confirm the purity and concentration prior to Covaris (Covaris, Inc., Woburn, MA USA) fragmentation. Fragmented genomic DNAs were tested for size distribution and concentration using an Agilent Tapestation and Nanodrop. Illumina libraries were made from qualified fragmented genomic DNA using NEBNext reagents (New England Biolabs), and the resulting libraries were subjected to exome enrichment using NimbleGen SeqCap EZ Human Exome Library v2.0 (Roche NimbleGen) following manufacturer’s instructions. Enriched libraries were tested for enrichment by qPCR and for size distribution and concentration by an Agilent Bioanalyzer 2100. The samples were then sequenced on an Illumina HiSeq2000 which generated paired-end reads of 90 or 100 nucleotides (nt). Data was analyzed for data quality, exome coverage, and exome-wide SNP/InDel using the platform provided by DNAnexus (DNAnexus, Inc).
SNP karyotyping
SNP karyotype analysis was performed on the Illumina’s CytoSNP-850K genotyping microarrays, which measure approximately 850,000 SNPs across the genome. All genomic DNA was isolated from iPSC clones according to the manufacturer’s protocol (Qiagen). Input genomic DNA (500 ng) was processed, hybridized to the array and scanned on an Illumina HiScan according to the manufacturer’s instructions. Copy number variations (CNVs) were identified using the cnvPartition Pluginv.3.2.0 in GenomeStudio (Illumina) by assessing both the B-allele-frequency and Log R ratios.
Quantitative RT-PCR
Total RNA was isolated from iPSC-CMs using the Qiagen RNeasy Mini kit. 1 μg of RNA was used to synthesize cDNA using the iScript cDNA Synthesis kit (Bio-Rad). 0.25 μl of the reaction was used to quantify gene expression by qPCR using TaqMan Universal PCR Master Mix. Expression values were normalized to the average expression of housekeeping gene 18s.
Intracellular Ca2+ imaging and analysis
For ratiometric calcium imaging, dissociated iPSC-CMs were seeded on Matrigel-coated coverslips (CS-24/50, thickness 1 mm, Warner Instruments). After 7 days, cells were loaded with 5 μM Fura-2AM (Thermo Fisher Scientific) with 0.02% Pluronic F-127 (Thermo Fisher Scientific) in Tyrode’s solution for 10 min at room temperature, followed by washing with Tyrode’s solution. iPSC-CMs were field-stimulated at 0.5 Hz at 37°C. Single cell Ca2+ imaging was conducted on a Nikon Eclipse Ti-E inverted microscope with a 40x oil immersion objective (0.95 NA). Fura-2 was excited at 340 nm and 380 nm wavelengths using a Lambda DG-4 ultra-high-speed wavelength switcher (Sutter Instrument), and the emission was collected at 510 nm wavelength.
Raw data were analyzed using a custom Python script (https://github.com/GeorgeMcMullen/CalciPy) built specifically to automate processing of ratiometric calcium imaging data [16].
Contractility assays
Throughout the study, contraction analysis was performed using a high-speed video microscopy with motion vector analysis to investigate the contractile characteristics of iPSC-CM monolayers. Depending on the design of the experiment, iPSC-CMs were seeded at 2x105 cells/cm2 into 384-well or 96-well plates. Contractility was measured using the Sony SI8000 cell motion imaging system. Video imaging of beating iPSC-CMs was recorded for 10 sec at a frame rate of 75 fps, a resolution of 1024 × 24 pixels, and a depth of 8 bits using a 10× objective on a fully automated Nikon microscope (Eclipse Ti, Nikon). Motion detection and analysis were performed using the Sony Cardio-analysis software (based on a block matching algorithm) [18].
Preparation and culture of engineered heart tissues (EHTs)
EHTs were prepared using a fibrin gel as previously described [19]. Briefly, EHTs were produced around silicone posts in agarose casting molds in a 24-well plate. Each EHT contained 1x106 iPSC-CMs in a fibrin matrix (100 μL total) composed of 10 μL Matrigel (Corning), 5 mg/ml bovine fibrinogen (2.53 μL of 200 mg/ml fibrinogen reconstituted in 0.9% NaCl) and supplemented with 0.1 mg/mL aprotinin (Sigma Aldrich) and 3 U/ml thrombin (Sigma Aldrich). EHTs were incubated for 2 hours at 37°C and then transferred to a new plate containing RPMI supplemented with B27 and 10% KnockOut serum replacement (Thermo Fischer Scientific). The medium was replaced every two days with RPMI supplemented with B27 and 33 μg/ml aprotinin.
Contractile analysis of EHTs
EHT contractile motion was recorded using the SI8000 Cell Motion Imaging System (Sony). The SI8000R Analyzer Software (Sony) was used to detect motion vectors and track the movement of each EHT post. Maximum post deflection from rest was extracted from each contraction cycle in the tracking data using a custom python script. Calculation of contractile force is a function of average distance travelled from each resting phase to its peak of contraction, combined with the physical properties of the posts considering an elastic modulus of 1.7 MPa, a post radius of 0.5 mm and a distance between posts (length) of 10 mm based on the equation:
Statistical analysis
Comparison between iPSC-CMs carrying the E1680K mutation and the isogenic controls was performed using unpaired Student's t-test. The criterion for significance was set at p < 0.05.
Results
Clinical presentation of early onset DCM
We have identified a family with consanguineous marriage from the Israeli Bedouin population of the Negev, who are affected by early-onset, severe DCM in an autosomal recessive pattern of inheritance (Fig 1). Five family members presented with acute DCM with clinical onset varying from prenatal (33 weeks of gestation) to five years of age. All five patients have died due to heart failure. The clinical presentation of each patient is detailed below and summarized in Table 1.
Patient III-1: First male child of healthy, consanguineous parents of Bedouin origin. Diagnosed with DCM at 33 weeks of gestation. Primary clinical features included respiratory distress, congestive heart failure (CHF), cardiogenic shock, and supraventricular tachycardia. Echocardiogram revealed severe LV dilation, reduced LV fractional shortening (LVFS), and mitral regurgitation (MR). Patient died at the age of two months.
Patient III-3: First male child of healthy, consanguineous parents of Bedouin origin, first cousin of Patient III-1. Documented to have normal cardiac size prior to DCM onset. Diagnosed with DCM at the age of five years after presentation to clinic with respiratory distress, followed by frequent hospitalization due to CHF. Patient exhibited normal cognitive development. Echocardiogram revealed severe LV dilation, reduced LVFS, moderate left ventricular hypertrophy (LVH), MR, and pulmonary hypertension (PH). Patient died at the age of 12 years.
Patient III-4: Younger brother of Patient III-3. Diagnosed with DCM at the age of two years after presentation to clinic with respiratory distress, followed by frequent hospitalization due to CHF. Patient achieved normal developmental milestones. Echocardiogram revealed severe LV dilation, reduced LVFS, severe MR, moderate LVH, moderate PH, and small muscular ventricular septal defect (VSD). Patient died at the age of four years.
Patient III-5: First female child of healthy, consanguineous parents of Bedouin origin, first cousin of Patient III-1 and III-3. Documented to have normal cardiac size and LVFS prior to DCM onset. Diagnosed with DCM at the age of one after presentation to clinic with respiratory distress and CHF during first year of life. Echocardiogram revealed moderate LV dilation, mildly reduced LVFS, moderate LVH, and moderate secundum atrial septal defect (ASD). Patient achieved normal developmental milestones and remained stable until 12 years of age, although follow-up revealed progressive deterioration of cardiac function (Table 1 and Fig 1B and 1C). Patient was frequently hospitalized due to CHF exacerbation and eventually died at the age of 16 years.
Patient III-6: Younger brother of Patient III-5. Documented to have normal cardiac size prior to DCM onset. Diagnosed with DCM at the age of two years after presentation to clinic with respiratory distress, followed by frequent hospitalization due to CHF. Patient achieved normal developmental milestones. Echocardiogram revealed severe LV dilation, reduced LVFS, moderate LVH, moderate MR, and PH. Patient died at the age of five years.
Two of the patients, III-4 and III-5, had associated congenital heart defects, VSD and ASD, respectively. Given that VSDs and ASDs are relatively common types of heart defects that present at birth [20] and were not seen in all affected patients, it is unlikely that these congenital defects are associated with the SPEG mutation. However, we cannot totally rule out this possibility. Notably, the normal cardiac size and function documented for two of the affected children prior to the clinical onset of DCM (III-3 and III-6) supports the notion that myocardial developmental defects unlikely contributed to the pathogenesis of DCM. Finally, the serum creatine kinase levels were evaluated in four of the five affected children and were in the normal range (Table 1), consistent with the clinical evaluation of normal skeletal muscle function in all the affected patients.
Linkage analysis and homozygosity mapping
The recessive pattern of DCM inheritance in the consanguineous family suggests homozygosity of a pathogenic mutation inherited from a common founder. In order to identify the disease-causing mutation, we first combined linkage analysis and homozygosity mapping to locate the genomic region, or linkage interval, that is associated with the disease. The linkage interval to be identified should show homozygosity in all DCM patients, and heterozygosity or homozygosity for a different allele in unaffected family members.
Patients III-3, III-5, and the mother of patient III-3 (II-4, healthy) were genotyped with the Affymetrix GeneChip Human Mapping 250K Sty Arrays and analyzed using the KinSNP software. Four chromosomal segments larger than 4 centiMorgan (cM) were shared by the two patients analyzed. Variable number tandem repeat (VNTR) analysis revealed heterozygosity in three of these segments in Patients III-3 and III-5, negating their involvement in pathogenesis. In contrast, all five affected patients in the family show homozygosity for eight different VNTR markers in the fourth segment (Fig 2). This 9.4cM segment is located at chr2 : 218,317,008–227,728,735 (Assembly: Mar. 2006 NCBI36/hg18) and delimited by VNTR markers AC073838.6 and AC019231.7. Primers used for PCR amplification of the VNTRs are listed in S2 Table. Statistical analysis using the PedTool Server yielded a two-point Lod Score of 3.66 for the fully informative AC053503-2 marker (Table 2) and a multiple-point Lod Score of 5.25, confirming linkage of this interval.
Exome sequence analysis
In order to identify mutation(s) that may have contributed to the development of DCM in the affected family members, we conducted whole exome sequencing in patient III-6 and identified four recessive variants within the linkage interval on chromosome 2: C2orf24, DNPEP, DOCK10, and SPEG (Table 3). To further explore whether these mutations are disease-causing or disease-associated, we examined their prevalence in the general population, conservation across species, and functional consequences by in silico predictions.
The C2orf24 (rs4674361) and DNPEP (rs907679) variants are single nucleotide polymorphisms (SNPs) with high allele frequency in the general population and are therefore unlikely to be pathogenic. A third recessive variant in DOCK10 (rs147752392) results in a glycine to arginine missense mutation (p.G570R). This variant is reported in the Genome Aggregation Database (GnomAD v2.1), the NHLBI Trans-Omics for Precision Medicine (TOPMed) Whole Genome Sequencing Program dataset, and the ExAC database with allelic frequency of 0.005122, 0.002915, and 0.00728, respectively. Notably, the GnomAD database includes nine homozygous DOCK10 p.G570R healthy carriers, negating the pathogenicity of this variant.
Finally, the fourth variant found in exon 23 of the SPEG gene (c. 5038G>A, p. E1680K, NM_005876) has not been reported in the GnomAD or TOPMed databases and therefore is unlikely to be a common polymorphism. All family members were Sanger sequenced for this variant which segregated as expected in the family (Fig 2). According to bioinformatic prediction, the SPEG gene has a probability of being loss of function intolerant (pLI) score of 1.00 and is predicted to be highly intolerant to variation [21]. The SPEG variant identified in our index family results in a missense mutation (p.E1680K) in the first of two SPEG serine/threonine protein kinase domains (Fig 3A and 3B). The amino acid residue implicated in this variant is highly conserved even across species (Fig 3C), further suggesting that changes in this residue are likely to be detrimental. Taken together, we concluded that SPEG E1680K is likely the pathogenic variant in our index family.
Generation of SPEG E1680K iPSC-CMs
We sought to validate the pathogenicity of SPEG E1680K in human iPSC-CMs. Using a CRISPR/Cas9-based genome editing approach we introduced the homozygous SPEG E1680K mutation in an iPSC line (hereafter referred to as SPEGMUT) derived from a healthy individual (Fig 4A and 4B). Another clone that was unmodified at the SPEG locus was isolated from the CRISPR-targeted parental line as a wildtype control (hereafter referred to as SPEGWT). These genetically engineered iPSCs lines differ exclusively at the edited locus and were otherwise isogenic. The genome-edited iPSCs were karyotypically normal and maintained their pluripotency as assessed by immunofluorescence staining for pluripotency markers (S1 Fig). Importantly, the CRISPR/Cas9-mediated genome editing approach did not introduce any unwanted alteration in the genome as assessed by genotyping of the top ten in silico predicted off-target loci (S2 Fig).
To assess the potential role of SPEG E1680K in cardiomyocyte physiology, we differentiated the SPEGMUT and isogenic control SPEGWT iPSCs into cardiomyocytes using established protocols that generate a nearly pure population (>90%) of cardiomyocytes. SPEG is a serine/threonine kinase that is highly expressed in the developing heart [22,23]. In agreement, we observed that the expression of SPEG was developmentally regulated with SPEG transcripts detected at an early stage of cardiac differentiation in vitro. Quantitative analysis showed comparable levels of SPEG mRNA expression between SPEGMUT and SPEGWT iPSC-CMs (S3 Fig). We attempted to quantify the expression of SPEG protein by Western blot analysis but it was unsuccessful because of lack of detection by commercially available antibodies. Next, we assessed the sarcomere integrity in the isogenic iPSC-CMs by immunofluorescence staining of cardiac troponin T and alpha-sarcomeric actinin to visualize the thin filaments and the z disk, respectively. Consistent with other iPSC-CM models of DCM [24–28], SPEGMUT iPSC-CMs exhibited disorganized myofibrils and abnormal, irregular sarcomeres with punctate staining, while SPEGWT iPSC-CMs showed well-aligned sarcomeres (Figs 4C and S4). We validated these observations by quantifying the ‘sarcomere packing density’ [17], a quantitative metric for the organization of the contractile cytoskeleton of iPSC-CMs (Figs 4D and S5).
Next, we investigated the effect of the E1680K mutation on cardiomyocyte function at the single-cell level. As aberrant calcium (Ca2+) homeostasis is a hallmark of DCM, we examined the calcium handling properties of SPEGMUT and isogenic SPEGWT control iPSC-CMs. We observed significant increases in the Ca2+-transient amplitude and faster Ca2+ decay kinetics in SPEGMUT iPSC-CMs compared to the isogenic controls (Fig 5A and 5C), which were associated with a significant decrease in phospholamban gene (PLN) expression (Fig 5B), a critical regulator of Ca2+ homeostasis in the heart. [29].
As DCM is characterized by a contractile defect, we next investigated the effect of the E1680K mutation on iPSC-CM contractility. Light microscopic video images of cardiomyocytes grown in monolayers were captured with a high-speed camera, and motion vectors were calculated with high spatiotemporal resolution using a block-matching algorithm [18]. Compared to SPEGWT isogenic controls, iPSC-CMs carrying the SPEG E1680K mutation exhibited a significant decrease in contractility (Fig 5D). We also examined the contractile properties of 3-dimensional (3D) EHTs, a micro-engineered model resembling human heart tissue that exhibits a higher degree of maturation compared to monolayer cultures [19]. In agreement with the findings in the 2D monolayer cultures, SPEGMUT generated significantly less force than SPEGWT iPSC-CMs in 3D EHTs (Fig 5E). Taken together, our findings suggest that the genetically engineered SPEG E1680K human iPSC-CMs recapitulated the hallmark phenotypes associated with DCM, including sarcomeric disorganization, aberrant Ca2+ homeostasis and contractile defects, suggesting that SPEG E1680K is a pathogenic variant.
Discussion
In this study, we discovered and validated a novel autosomal recessive variant in the SPEG gene (p.E1680K) associated with early-onset DCM, implicating SPEG as a new candidate gene for DCM. By combining human iPSCs and CRISPR/Cas9-mediated genome editing technologies, we showed that iPSC-CMs carrying the SPEG E1680K mutation recapitulated DCM phenotypes in vitro. Our study demonstrated the potential of using genetically engineered human iPSC-CMs as a human cellular model to validate the pathogenicity of variants associated with autosomal recessive DCM.
SPEG encodes the striated muscle enriched protein kinase, a recently identified member of the junctional membrane complex of the muscle [30]. Mutations in SPEG have recently been identified in patients with centronuclear myopathies (CNMs), a group of disorders characterized by severe muscle weakness with respiratory impairment, ophthalmoplegia, and scoliosis. Some CNM patients carrying homozygous or compound heterozygous SPEG mutations have been diagnosed with DCM, corroborating our findings implicating the SPEG E1680K mutation in DCM [31,32]. Unlike CNM patients who present with severe myopathies, the affected individuals in our index family presented with fulminant DCM without any clinical manifestation of myopathy. These observations suggest that SPEG mutations may play a role in DCM pathogenesis in a non-syndromic manner independent of skeletal muscle involvement.
Consistent with our findings, disruption of the Speg gene causes a DCM-like phenotype and perinatal death in mice [23,30,33], supporting the notion that SPEG plays an important role in cardiac physiology and pathophysiology. Nevertheless, the role of SPEG in cardiac function is poorly understood. Recent studies suggest that SPEG regulates calcium re-uptake into the sarcoplasmic reticulum by phosphorylating Sarcoplasmic/Endoplasmic Reticulum Calcium ATPase 2 (SERCA2a) in cardiomyocytes [34]. Inducible deletion of Speg in the mouse heart was found to have a profound impact on cardiac function by inhibiting the calcium-transport activity of SERCA2a and impairing calcium re-uptake into the SR in cardiomyocytes. In agreement with a role of SPEG in calcium homeostasis we have observed a significant decrease in the mRNA expression levels of PLN in the SPEG E1680K mutant compared to control iPSC-CMs, supporting the hypothesis that SPEG E1680K alters calcium dynamics by decreasing the expression of PLN. Consistently, the calcium amplitude were significantly increased and the decay kinetics were significantly accelerated in SPEG mutant iPSC-CMs compared to isogenic controls. The phenotype is reminiscent of transgenic animal models of genetic DCM carrying mutations in the thin filament genes [35,36]. Notably, phosphorylation of SERCA2a by SPEG was previously reported as a function unique to the second kinase-domain of SPEG [34]. Therefore, how E1680K, a mutation in the first kinase-domain of SPEG, affects cardiomyocyte calcium homeostasis remains an interesting question for future investigation.
In summary, we discovered and validated a novel variant in the SPEG gene (p.E1680K) associated with nonsyndromic autosomal recessive, early-onset DCM. Importantly, we have demonstrated in this study the potential of combining human iPSC-CMs with genome editing technologies to translate clinical genetic findings into a biological understanding of the disease pathogenesis. This experimental framework combined with clinical segregation data could be broadly applied to distinguish genuine DCM disease-causing or disease-associated genetic variants from the broader genetic background where rare recessive variants are identified. A better understanding of the DCM etiology could ultimately improve our ability to care for patients at the bedside.
Limitations
The major limitation of the current study is the lack of mechanistic links between the SPEG E1680K mutation and the pathogenesis of DCM, as well as the fact that homozygous variants are rare in DCM and SPEG heterozygous variants may not necessarily be disease-causing. Finally, the in vitro analyses of suspected pathogenic mutations using the iPSC-CM model can provide significant insights; however, these models do not always reflect the in vivo milieu.
Ethics Statement
The study was approved by the Soroka Medical Center institutional review board. Human iPSCs were derived with approval from the Institutional Review Board at Stanford University (IRB-29904). All participants gave written informed consent prior to participation.
Supporting information
S1 Fig [a]
Pluripotency of isogenic genome edited iPSCs.
S2 Fig [tif]
Analysis of off-targets events in isogenic CRISPR/Cas9 edited iPSCs.
S3 Fig [wt]
Relative SPEG mRNA expression levels.
S4 Fig [tif]
Assessment of sarcomere structure.
S5 Fig [gray]
Quantification of Sarcomere Packing Density.
S1 Table [docx]
PCR Primers used for off target detection.
S2 Table [docx]
Primers for PCR amplification of VNTRs and SNPs.
S1 Note [m]
Matlab Script to quantify sarcomere alignment.
S2 Note [fig]
Matlab GUI to quantify sarcomere alignment.
Zdroje
1. McNally EM, Golbus JR, Puckelwartz MJ. Genetic mutations and mechanisms in dilated cardiomyopathy. J Clin Invest. 2013;123(1):19–26. Epub 2013/01/02. doi: 10.1172/JCI62862 23281406; PubMed Central PMCID: PMC3533274.
2. Towbin JA, Lowe AM, Colan SD, Sleeper LA, Orav EJ, Clunie S, et al. Incidence, causes, and outcomes of dilated cardiomyopathy in children. Jama. 2006;296(15):1867–76. doi: 10.1001/jama.296.15.1867 17047217.
3. Watkins H, Ashrafian H, Redwood C. Inherited cardiomyopathies. New England Journal of Medicine. 2011;364(17):1643–56. doi: 10.1056/NEJMra0902923 21524215
4. Dellefave L, McNally EM. The genetics of dilated cardiomyopathy. Curr Opin Cardiol. 2010;25(3):198–204. doi: 10.1097/HCO.0b013e328337ba52 20186049; PubMed Central PMCID: PMC2939233.
5. Hershberger RE, Hedges DJ, Morales A. Dilated cardiomyopathy: the complexity of a diverse genetic architecture. Nature reviews Cardiology. 2013;10(9):531. doi: 10.1038/nrcardio.2013.105 23900355
6. Kärkkäinen S, Peuhkurinen K. Genetics of dilated cardiomyopathy. Annals of medicine. 2007;39(2):91–107. doi: 10.1080/07853890601145821 17453673
7. Hershberger RE, Morales A, Siegfried JD. Clinical and genetic issues in dilated cardiomyopathy: a review for genetics professionals. Genetics in medicine: official journal of the American College of Medical Genetics. 2010;12(11):655–67. doi: 10.1097/GIM.0b013e3181f2481f 20864896; PubMed Central PMCID: PMC3118426.
8. Burkett EL, Hershberger RE. Clinical and genetic issues in familial dilated cardiomyopathy. Journal of the American College of Cardiology. 2005;45(7):969–81. doi: 10.1016/j.jacc.2004.11.066 15808750.
9. Lefeber DJ, de Brouwer AP, Morava E, Riemersma M, Schuurs-Hoeijmakers JH, Absmanner B, et al. Autosomal recessive dilated cardiomyopathy due to DOLK mutations results from abnormal dystroglycan O-mannosylation. PLoS genetics. 2011;7(12):e1002427. doi: 10.1371/journal.pgen.1002427 22242004; PubMed Central PMCID: PMC3248466.
10. Lakdawala NK, Funke BH, Baxter S, Cirino AL, Roberts AE, Judge DP, et al. Genetic testing for dilated cardiomyopathy in clinical practice. Journal of cardiac failure. 2012;18(4):296–303. doi: 10.1016/j.cardfail.2012.01.013 22464770; PubMed Central PMCID: PMC3666099.
11. Pugh TJ, Kelly MA, Gowrisankar S, Hynes E, Seidman MA, Baxter SM, et al. The landscape of genetic variation in dilated cardiomyopathy as surveyed by clinical DNA sequencing. Genetics in medicine: official journal of the American College of Medical Genetics. 2014;16(8):601–8. doi: 10.1038/gim.2013.204 24503780.
12. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007;131(5):861–72. doi: 10.1016/j.cell.2007.11.019 18035408.
13. Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 2014;346(6213):1258096. doi: 10.1126/science.1258096 25430774.
14. Matsa E, Burridge PW, Wu JC. Human stem cells for modeling heart disease and for drug discovery. Science translational medicine. 2014;6(239):239ps6. doi: 10.1126/scitranslmed.3008921 24898747; PubMed Central PMCID: PMC4215696.
15. Karakikes I, Ameen M, Termglinchan V, Wu JC. Human induced pluripotent stem cell-derived cardiomyocytes: insights into molecular, cellular, and functional phenotypes. Circulation research. 2015;117(1):80–8. doi: 10.1161/CIRCRESAHA.117.305365 26089365; PubMed Central PMCID: PMC4546707.
16. Seeger T, Shrestha R, Lam CK, Chen C, McKeithan WL, Lau E, et al. A Premature Termination Codon Mutation in MYBPC3 Causes Hypertrophic Cardiomyopathy via Chronic Activation of Nonsense-Mediated Decay. Circulation. 2019;139(6):799–811. doi: 10.1161/CIRCULATIONAHA.118.034624 30586709; PubMed Central PMCID: PMC6443405.
17. Pasqualini FS, Sheehy SP, Agarwal A, Aratyn-Schaus Y, Parker KK. Structural phenotyping of stem cell-derived cardiomyocytes. Stem cell reports. 2015;4(3):340–7. doi: 10.1016/j.stemcr.2015.01.020 25733020; PubMed Central PMCID: PMC4375945.
18. Hayakawa T, Kunihiro T, Dowaki S, Uno H, Matsui E, Uchida M, et al. Noninvasive evaluation of contractile behavior of cardiomyocyte monolayers based on motion vector analysis. Tissue engineering Part C, Methods. 2012;18(1):21–32. doi: 10.1089/ten.TEC.2011.0273 21851323.
19. Mannhardt I, Breckwoldt K, Letuffe-Breniere D, Schaaf S, Schulz H, Neuber C, et al. Human Engineered Heart Tissue: Analysis of Contractile Force. Stem cell reports. 2016;7(1):29–42. doi: 10.1016/j.stemcr.2016.04.011 27211213; PubMed Central PMCID: PMC4944531.
20. Mai CT, Isenburg JL, Canfield MA, Meyer RE, Correa A, Alverson CJ, et al. National population-based estimates for major birth defects, 2010–2014. Birth defects research. 2019;111(18):1420–35. doi: 10.1002/bdr2.1589 31580536; PubMed Central PMCID: PMC7203968.
21. Petrovski S, Gussow AB, Wang Q, Halvorsen M, Han Y, Weir WH, et al. The intolerance of regulatory sequence to genetic variation predicts gene dosage sensitivity. PLoS genetics. 2015;11(9):e1005492. doi: 10.1371/journal.pgen.1005492 26332131
22. Hsieh CM, Fukumoto S, Layne MD, Maemura K, Charles H, Patel A, et al. Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1. The Journal of biological chemistry. 2000;275(47):36966–73. doi: 10.1074/jbc.M006028200 10973969.
23. Liu X, Ramjiganesh T, Chen YH, Chung SW, Hall SR, Schissel SL, et al. Disruption of striated preferentially expressed gene locus leads to dilated cardiomyopathy in mice. Circulation. 2009;119(2):261–8. doi: 10.1161/CIRCULATIONAHA.108.799536 19118250; PubMed Central PMCID: PMC2630246.
24. Hinson JT, Chopra A, Nafissi N, Polacheck WJ, Benson CC, Swist S, et al. HEART DISEASE. Titin mutations in iPS cells define sarcomere insufficiency as a cause of dilated cardiomyopathy. Science. 2015;349(6251):982–6. doi: 10.1126/science.aaa5458 26315439; PubMed Central PMCID: PMC4618316.
25. Zaunbrecher RJ, Abel AN, Beussman K, Leonard A, von Frieling-Salewsky M, Fields PA, et al. Cronos Titin Is Expressed in Human Cardiomyocytes and Necessary for Normal Sarcomere Function. Circulation. 2019;140(20):1647–60. doi: 10.1161/CIRCULATIONAHA.119.039521 31587567; PubMed Central PMCID: PMC6911360.
26. Wyles SP, Hrstka SC, Reyes S, Terzic A, Olson TM, Nelson TJ. Pharmacological Modulation of Calcium Homeostasis in Familial Dilated Cardiomyopathy: An In Vitro Analysis From an RBM20 Patient-Derived iPSC Model. Clinical and translational science. 2016;9(3):158–67. doi: 10.1111/cts.12393 27105042; PubMed Central PMCID: PMC4902766.
27. Wyles SP, Li X, Hrstka SC, Reyes S, Oommen S, Beraldi R, et al. Modeling structural and functional deficiencies of RBM20 familial dilated cardiomyopathy using human induced pluripotent stem cells. Human molecular genetics. 2016;25(2):254–65. doi: 10.1093/hmg/ddv468 26604136; PubMed Central PMCID: PMC4706113.
28. Streckfuss-Bomeke K, Tiburcy M, Fomin A, Luo X, Li W, Fischer C, et al. Severe DCM phenotype of patient harboring RBM20 mutation S635A can be modeled by patient-specific induced pluripotent stem cell-derived cardiomyocytes. J Mol Cell Cardiol. 2017;113 : 9–21. doi: 10.1016/j.yjmcc.2017.09.008 28941705.
29. MacLennan DH, Kranias EG. Phospholamban: a crucial regulator of cardiac contractility. Nature reviews Molecular cell biology. 2003;4(7):566–77. doi: 10.1038/nrm1151 12838339.
30. Quick AP, Wang Q, Philippen LE, Barreto-Torres G, Chiang DY, Beavers D, et al. SPEG (Striated Muscle Preferentially Expressed Protein Kinase) Is Essential for Cardiac Function by Regulating Junctional Membrane Complex Activity. Circulation research. 2017;120(1):110–9. doi: 10.1161/CIRCRESAHA.116.309977 27729468; PubMed Central PMCID: PMC5218854.
31. Agrawal PB, Pierson CR, Joshi M, Liu X, Ravenscroft G, Moghadaszadeh B, et al. SPEG interacts with myotubularin, and its deficiency causes centronuclear myopathy with dilated cardiomyopathy. American journal of human genetics. 2014;95(2):218–26. doi: 10.1016/j.ajhg.2014.07.004 25087613; PubMed Central PMCID: PMC4129406.
32. Qualls AE, Donkervoort S, Herkert JC, D'Gama A M, Bharucha-Goebel D, Collins J, et al. Novel SPEG mutations in congenital myopathies: Genotype-phenotype correlations. Muscle & nerve. 2019;59(3):357–62. doi: 10.1002/mus.26378 30412272.
33. Liu X, Hall SRR, Wang Z, Huang H, Ghanta S, Di Sante M, et al. Rescue of neonatal cardiac dysfunction in mice by administration of cardiac progenitor cells in utero. Nature communications. 2015;6 : 8825. doi: 10.1038/ncomms9825 26593099; PubMed Central PMCID: PMC4673493.
34. Quan C, Li M, Du Q, Chen Q, Wang H, Campbell D, et al. SPEG Controls Calcium Reuptake Into the Sarcoplasmic Reticulum Through Regulating SERCA2a by Its Second Kinase-Domain. Circulation research. 2019;124(5):712–26. doi: 10.1161/CIRCRESAHA.118.313916 30566039.
35. Davis J, Davis LC, Correll RN, Makarewich CA, Schwanekamp JA, Moussavi-Harami F, et al. A Tension-Based Model Distinguishes Hypertrophic versus Dilated Cardiomyopathy. Cell. 2016;165(5):1147–59. doi: 10.1016/j.cell.2016.04.002 27114035; PubMed Central PMCID: PMC4874838.
36. Du CK, Morimoto S, Nishii K, Minakami R, Ohta M, Tadano N, et al. Knock-in mouse model of dilated cardiomyopathy caused by troponin mutation. Circulation research. 2007;101(2):185–94. doi: 10.1161/CIRCRESAHA.106.146670 17556660.
Článek vyšel v časopise
PLOS Genetics
2020 Číslo 9
- Máj pod bílým pláštěm aneb když mezi směnami vykvete láska
- Masturbační chování žen v ČR − dotazníková studie
- Bezpečnost dlouhodobé terapie osteoporózy – aktuální data
- Negativní vliv práce na noční směny na parametry lidského zdraví
- „Chytrá“ podprsenka jako pomocník při detekci nádorů prsu
-
Všechny články tohoto čísla
- Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons
- Coordinate genomic association of transcription factors controlled by an imported quorum sensing peptide in Cryptococcus neoformans
- Using prior information from humans to prioritize genes and gene-associated variants for complex traits in livestock
- The STRIPAK signaling complex regulates dephosphorylation of GUL1, an RNA-binding protein that shuttles on endosomes
- PIG-1 MELK-dependent phosphorylation of nonmuscle myosin II promotes apoptosis through CES-1 Snail partitioning
- Trappc9 deficiency causes parent-of-origin dependent microcephaly and obesity
- A mega-analysis of expression quantitative trait loci in retinal tissue
- Genetic analysis of the modern Australian labradoodle dog breed reveals an excess of the poodle genome
- Trichoderma reesei XYR1 activates cellulase gene expression via interaction with the Mediator subunit TrGAL11 to recruit RNA polymerase II
- Imaginal disc growth factor maintains cuticle structure and controls melanization in the spot pattern formation of Bombyx mori
- The Arabidopsis PHD-finger protein EDM2 has multiple roles in balancing NLR immune receptor gene expression
- A Novel Recessive Mutation in SPEG Causes Early Onset Dilated Cardiomyopathy
- Excess crossovers impede faithful meiotic chromosome segregation in C. elegans
- Cocoonase is indispensable for Lepidoptera insects breaking the sealed cocoon
- Male-biased aganglionic megacolon in the TashT mouse model of Hirschsprung disease involves upregulation of p53 protein activity and Ddx3y gene expression
- Candidate variants in TUB are associated with familial tremor
- Restriction on self-renewing asymmetric division is coupled to terminal asymmetric division in the Drosophila CNS
- Leveraging correlations between variants in polygenic risk scores to detect heterogeneity in GWAS cohorts
- ZNF423 patient variants, truncations, and in-frame deletions in mice define an allele-dependent range of midline brain abnormalities
- The causal effect of obesity on prediabetes and insulin resistance reveals the important role of adipose tissue in insulin resistance
- Adiponectin GWAS loci harboring extensive allelic heterogeneity exhibit distinct molecular consequences
- Deficiency of the Tbc1d21 gene causes male infertility with morphological abnormalities of the sperm mitochondria and flagellum in mice
- TENET 2.0: Identification of key transcriptional regulators and enhancers in lung adenocarcinoma
- Biological insights from multi-omic analysis of 31 genomic risk loci for adult hearing difficulty
- Prioritizing sequence variants in conserved non-coding elements in the chicken genome using chCADD
- A nonsense variant in Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) is associated with equine familial isolated hypoparathyroidism in Thoroughbred foals
- Mutually exclusive dendritic arbors in C. elegans neurons share a common architecture and convergent molecular cues
- Polygenic risk for autism spectrum disorder associates with anger recognition in a neurodevelopment-focused phenome-wide scan of unaffected youths from a population-based cohort
- Aldh inhibitor restores auditory function in a mouse model of human deafness
- AMP1 and CYP78A5/7 act through a common pathway to govern cell fate maintenance in Arabidopsis thaliana
- NFIA differentially controls adipogenic and myogenic gene program through distinct pathways to ensure brown and beige adipocyte differentiation
- Meiotic cohesins mediate initial loading of HORMAD1 to the chromosomes and coordinate SC formation during meiotic prophase
- Snf1 AMPK positively regulates ER-phagy via expression control of Atg39 autophagy receptor in yeast ER stress response
- Cis-regulatory differences in isoform expression associate with life history strategy variation in Atlantic salmon
- Correction: Systems genomics approaches provide new insights into Arabidopsis thaliana root growth regulation under combinatorial mineral nutrient limitation
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle
- Cocoonase is indispensable for Lepidoptera insects breaking the sealed cocoon
- Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons
- Trichoderma reesei XYR1 activates cellulase gene expression via interaction with the Mediator subunit TrGAL11 to recruit RNA polymerase II
- Adiponectin GWAS loci harboring extensive allelic heterogeneity exhibit distinct molecular consequences
Zvyšte si kvalifikaci online z pohodlí domova
Mazová zátka a její řešení
nový kurzVšechny kurzy