MNS1 Is Essential for Spermiogenesis and Motile Ciliary Functions in Mice
During spermiogenesis, haploid round spermatids undergo dramatic cell differentiation and morphogenesis to give rise to mature spermatozoa for fertilization, including nuclear elongation, chromatin remodeling, acrosome formation, and development of flagella. The molecular mechanisms underlining these fundamental processes remain poorly understood. Here, we report that MNS1, a coiled-coil protein of unknown function, is essential for spermiogenesis. We find that MNS1 is expressed in the germ cells in the testes and localizes to sperm flagella in a detergent-resistant manner, indicating that it is an integral component of flagella. MNS1–deficient males are sterile, as they exhibit a sharp reduction in sperm production and the remnant sperm are immotile with abnormal short tails. In MNS1–deficient sperm flagella, the characteristic arrangement of “9+2” microtubules and outer dense fibers are completely disrupted. In addition, MNS1–deficient mice display situs inversus and hydrocephalus. MNS1–deficient tracheal motile cilia lack some outer dynein arms in the axoneme. Moreover, MNS1 monomers interact with each other and are able to form polymers in cultured somatic cells. These results demonstrate that MNS1 is essential for spermiogenesis, the assembly of sperm flagella, and motile ciliary functions.
Published in the journal:
. PLoS Genet 8(3): e32767. doi:10.1371/journal.pgen.1002516
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1002516
Summary
During spermiogenesis, haploid round spermatids undergo dramatic cell differentiation and morphogenesis to give rise to mature spermatozoa for fertilization, including nuclear elongation, chromatin remodeling, acrosome formation, and development of flagella. The molecular mechanisms underlining these fundamental processes remain poorly understood. Here, we report that MNS1, a coiled-coil protein of unknown function, is essential for spermiogenesis. We find that MNS1 is expressed in the germ cells in the testes and localizes to sperm flagella in a detergent-resistant manner, indicating that it is an integral component of flagella. MNS1–deficient males are sterile, as they exhibit a sharp reduction in sperm production and the remnant sperm are immotile with abnormal short tails. In MNS1–deficient sperm flagella, the characteristic arrangement of “9+2” microtubules and outer dense fibers are completely disrupted. In addition, MNS1–deficient mice display situs inversus and hydrocephalus. MNS1–deficient tracheal motile cilia lack some outer dynein arms in the axoneme. Moreover, MNS1 monomers interact with each other and are able to form polymers in cultured somatic cells. These results demonstrate that MNS1 is essential for spermiogenesis, the assembly of sperm flagella, and motile ciliary functions.
Introduction
Spermatogenesis is divided into three phases: mitotic, meiotic and haploid. During the haploid phase (spermiogenesis), spermatids undergo a complex differentiation process to develop into spermatozoa, including chromatin remodeling, nuclear elongation, cytoplasm elimination, acrosome formation, and flagellum development [1]. The sperm flagellum is a complex structure whose integrity is essential for sperm motility and fertilization of the egg [2], [3]. Structural defects in the flagella of sperm from infertile men are responsible for motility abnormalities and may underlie some cases of male infertility in humans [4].
In contrast with flagella, cilia are present in nearly all cell types in vertebrate and play diverse functions [5], [6]. For example, respiratory cilia are important for mucus clearance [7]. Ependymal cilia facilitate cerebrospinal fluid flow [8]–[10]. Nodal cilia are essential for left-right asymmetry patterning during embryogenesis [11], [12]. Flagella and some motile cilia such as respiratory and ependymal cilia consist of nine outer doublet microtubules and one pair of single microtubules in the center (9+2 axoneme). Nodal cilia lack the central pair of microtubules and thus contain a 9+0 axoneme. In the axoneme of motile cilia, dynein arms, ATP-dependent motor proteins, are attached to and projected from outer doublet microtubules. Primary ciliary dyskinesia (PCD) is a heterogeneous group of autosomal recessive disorders characterized by recurrent respiratory infections [13]. Half of PCD patients display situs inversus and PCD is sometimes associated with male infertility. Flagella and cilia are complex structures that consist of >600 proteins [5]. Genetic studies in diverse organisms have begun to uncover the role for some of these proteins in ciliary and flagellar functions [9], [10], .
Mouse MNS1 (meiosis-specific nuclear structural protein 1) was previously identified due to cross-reactivity with an anti-lamin antibody in a study of the perinuclear matrix [20]. In this original investigation, MNS1 appeared to be expressed specifically in testes. The MNS1 protein contains long coiled-coil domains but no other known functional motifs. In that report, it was concluded that MNS1 was specifically expressed in pachytene spermatocytes and thus might function in maintaining proper nuclear morphology during meiosis [20]. However, the physiological function of MNS1 remains unknown. Here we report that, in contrast with the previous study [20], MNS1 is abundantly expressed in post-meiotic spermatids and is required for spermiogenesis. In addition, MNS1 is also required for motile ciliary functions.
Results
MNS1, a Coiled-Coil Protein, Is an Integral Component of Sperm Flagella
To study the expression and localization of MNS1, we generated specific antibodies against the N-terminal and C-terminal fragments of mouse MNS1 respectively. Western blot analysis of adult mouse tissues revealed that MNS1 is abundantly expressed as two closely migrating protein species in the testis but not in other tissues except at very low levels in lung and ovary (Figure 1A). Immunofluorescence analysis showed that the expression of MNS1 is restricted to germ cells in the testis and appears to be predominantly cytoplasmic (Figure S1). The MNS1 protein was first detected at a low level in pachytene spermatocytes at stage VIII and then was abundantly expressed in late pachytene spermatocytes, diplotene spermatocytes, and post-meiotic spermatids (Figure S1). MNS1 was not detected in early germ cells ranging from spermatogonia to mid-pachytene spermatocytes (Figure S1). Our results showed that the expression of MNS1 is not restricted to pachytene spermatocytes as had been previously reported [20].
Immunofluorescence analysis showed that MNS1 localizes to sperm flagella (Figure 1B). In contrast with the relatively continuous distribution of tubulin in the sperm tail, MNS1 localization was not uniform, appearing in a dot-on-a-string fashion (Figure 1B, inset). Our MNS1 antibody was specific, since no staining was observed with Mns1-deficient sperm (data not shown). To assess the biochemical nature of MNS1 localization in sperm tails, we treated epididymal sperm with SDS-EDTA solution to divide sperm proteins into two fractions: soluble (supernatant) and SDS-resistant (pellet) (Figure 1C) [21], [22]. While SDS-treatment solublizes the tubulin components of the axoneme, other axonemal components (such as Tektin), outer dense fibers (ODF), mitochondrial sheath (MS), and fibrous sheath (FS) remain in the SDS-resistant structures [22], [23]. Western blot analysis showed that MNS1, like ODF2, resides in the SDS-resistant flagellar structures (Figure 1C). This result was consistent with the identification of MNS1 as one of the SDS-resistant proteins in the sperm flagella in a systematic proteomic profiling study [22]. As expected, MNS1 still localizes to SDS-treated sperm flagellar remnants (Figure 1D). Collectively, these data demonstrate that MNS1 is an integral component of sperm flagella.
MNS1 Is Essential for Spermiogenesis and Male Fertility
To determine the requirement of Mns1 for spermatogenesis, we generated Mns1 mutant mice by homologous recombination in embryonic stem (ES) cells (Figure 2A). Mouse Mns1 (encoding a protein of 491 aa) is a 10-exon gene spanning over a 20-kb genomic region on Chr. 9. In the Mns1 mutant, deletion of exons 3–8 removes aa 76–423 (Figure 2A). As expected, the internally deleted MNS1 protein (143 aa, MNS1Δ) was expressed in Mns1+/− and Mns1−/− testes (Figure 2B). Western blot analysis revealed two additional MNS1 cross-reactive bands (∼32–37 kD) in the testis (Figure 2B). These two intermediate bands were likely to be specific to MNS1, since they were not detected in Mns1−/− testes (Figure 2B). However, neither the two intermediate protein species nor MNS1Δ was detected in mutant sperm, suggesting that they are not incorporated into the flagella (Figure 2C).
Interbreeding of heterozygous mice yielded slightly fewer homozygous Mns1 mutant offspring (Mns1+/+, Mns1+/−, Mns1−/−: 73, 155, 50) (χ2 = 7.49, P = 0.024), suggesting lethality in some Mns1-deficient embryos or pups. However, Mns1−/− mice grew to adulthood with no gross abnormalities and no increased lethality was observed in Mns1−/− mice after weaning. The body weight of Mns1−/− adult mice was not different from that of wild type animals. Notably, Mns1−/− males were sterile, whereas Mns1−/− females were fertile. The weight of Mns1−/− testes (158±18 mg per pair) from 8-wk-old mice was slightly lower (13%) than that of the wild type (182±10 mg per pair) (Student's t test, P<0.019). Strikingly, the sperm count from Mns1−/− epididymides (0.77×106 per cauda) was dramatically reduced to only 8% of the wild type level (9.4×106 per cauda) (P<0.0001). The Mns1-deficient epididymides were mostly filled with cell debris and contained much fewer sperm (Figure S2). Histological analysis revealed that seminiferous tubules from adult Mns1−/− testes contained all stages of germ cells but the mutant elongated spermatids appeared to lack flagella, in comparison with wild type elongated spermatids (Figure 2D, 2E). Thus, MNS1 is required for male fertility and is essential for spermiogenesis.
MNS1 Is Required for the Assembly of Sperm Flagella
We next analyzed the sperm from the cauda epididymis. The sperm flagellum is divided into the midpiece, principal piece, and the short end piece (Figure 3A). We found that the great majority (98%) of sperm from Mns1−/− mice have a very short crooked tail (less than 25% the wild type length) (Figure 3A, 3B). Rarely, sperm with a long flagellum was observed but its flagellum appeared to be abnormal (Figure 3B). In addition to abnormal flagellar morphology, freshly isolated MNS1-deficient sperm exhibited no motility upon microscopic examination. However, the head of MNS1-deficient sperm appeared normal in morphology (Figure 3D, inset) and contained protamine 1 (Figure S3), suggesting that nuclear elongation and nuclear condensation events were not disrupted during spermiogenesis in MNS1-deficient mice. Acrosomes in MNS1-deficient sperm also appeared to be normal in morphology (Figure 3D).
Morphological analysis revealed abnormal assembly of sperm flagella in Mns1−/− mice. Immunofluorescence microscopy showed that MNS1-deficient sperm flagella were positive for tubulin, demonstrating the presence of microtubules (Figure 3D). In addition to the “9+2” microtubular axoneme and outer dense fibers (ODFs) of the wild type flagella, the midpiece and principal piece consist of mitochondrial sheath and fibrous sheath respectively (Figure 3E, 3G). In the MNS1-deficient flagella, the axonemal microtubules and ODFs were completely disorganized (Figure 3F, 3H). The mitochondrial sheath did form but in uneven thickness around the axoneme in the midpiece of the mutant sperm (Figure 3F). The fibrous sheath appeared to be missing in the principal piece of MNS1-deficient sperm (Figure 3H). These analyses demonstrated that MNS1 is essential for the assembly of sperm flagella in mice.
Randomized Left–Right Asymmetry and Hydrocephalus in MNS1–Deficient Mice
We next tested whether MNS1 is required for somatic ciliary functions. Motile cilia such as ependymal cilia and nodal cilia, also consist of axonemes. Nodal cilia are required for left-right patterning of internal organs during embryogenesis and nodal ciliary dysfunction causes situs inversus [11], [12]. Ependymal cilia are responsible for the flow of cerebrospinal fluid and their defects lead to hydrocephalus [8]–[10]. We found that Mns1−/− mice exhibited abnormal left-right asymmetry. Based on lung lobation patterns, all 13 wild type and 34 Mns1+/− embryos exhibited normal left-right patterning (Figure 4A). However, eight of 22 Mns1−/− embryos examined (E12.5–E16.5) displayed normal situs, eight presented with situs inversus (Figure 4B), and six exhibited left isomerism, indicating that MNS1 is required for nodal ciliary function. In contrast with wild type mice (Figure 4C), post-natal day 24-old Mns1−/− mice developed hydrocephalus (Figure 4D), suggesting that MNS1 is also important for ependymal ciliary function. By histological analysis of brain from mice at post-natal days 2, 4, and 16, we found that Mns1-deficient mice exhibited no hydrocephalus at post-natal day 2 but began to develop hydrocephalus at post-natal day 4. Taken together, these data have shown that MNS1 is essential for motile ciliary functions.
Non-motile cilia are thought to be involved in sensory perception and thus are important for signaling processes such as Hedgehog and Wnt signaling pathways [24], [25]. Defects in non-motile ciliary functions cause polycystic kidney disease, polydactyly, retinal degeneration, etc [5], [6]. However, the MNS1-deficient mice lacked polycystic kidney disease and polydactyly, suggesting that MNS1 is not required for non-motile ciliary functions.
Defects in Outer Dynein Arms in MNS1–Deficient Tracheal Motile Cilia
Next we performed ultrastructural analysis of tracheal motile cilia. Unlike the disorganized axonemal structure in MNS1-deficient sperm flagella (Figure 3), the characteristic “9+2” axonemal structure was present in MNS1-deficient tracheal cilia (Figure 5A, 5B). However, close examination revealed that MNS1-deficient motile cilia lack some outer dynein arms and contain only ∼4 of them (3.8±1.6, n = 24) per cross section, in contrast with the 9 outer dynein arms in the wild type (Figure 5B), suggesting that MNS1 is an axonemal protein. MNS1 was previously identified in the ciliary proteome of human bronchial epithelial cells [26]. Our Western blot analysis showed that MNS1 protein is expressed in wild type trachea but absent in Mns1−/− trachea (Figure 5C).
MNS1 Monomers Interact with Each Other
To elucidate a potential molecular mechanism for the function of MNS1 in spermiogenesis and motile ciliary functions, we performed a yeast two-hybrid screen of a human testis cDNA library using the full-length human MNS1 as bait. In this screen, we identified clones encoding the C-terminal half of MNS1. We confirmed the self-interaction of mouse MNS1 by yeast two-hybrid assay (data not shown). We then performed GST pulldown experiments to test if MNS1 physically binds to itself. These in vitro experiments showed that MNS1 binds to GST-MNS1N, GST-MNS1C. and GST-MNS1Δ, but not GST alone, indicating that MNS1 might form dimers or oligomers (Figure 6A). The self-interaction of MNS1 could be mediated by its coiled-coil domain, as both MNS1N and MNS1C contain coiled coil domains. We then analyzed the secondary structure of MNS1Δ (143 aa), which consists of the N-terminal 75 residues and the C-terminal 68 residues (Figure 6B). MNS1Δ was predicted to harbor a coiled coil domain in its middle region, which spans residues from both fragments. Therefore, the coiled coil domain in MNS1Δ may mediate its interaction with the full-length MNS1.
To determine whether MNS1 is able to form oligomers, we expressed MNS1 in NIH 3T3 fibroblast cells. Our data suggest that the full-length MNS1 protein forms short filaments in the cytoplasm (Figure 6B and Figure S4A). In contrast, the three MNS1 truncated proteins (MNS1N, MNS1C, or MNS1Δ) localized diffusely throughout the cells and did not form filaments (Figure 6B and Figure S4B–S4D). These data suggest that only the full-length MNS1 protein is capable of forming polymers. Although over-expression of the full length MNS1 may form non-specific aggregates rather than organized polymers in this assay, we favor the interpretation that MNS1 forms filaments. However, additional electron microscopic and biochemical studies are required to fully understand the structural basis.
Using this filament formation assay, we then tested if the three truncated MNS1 proteins would incorporate into the full-length MNS1 structures (Figure 6B). We co-expressed the full-length MNS1 and each of the three truncated MNS1-GFP fusion proteins in NIH 3T3 cells (Figure 6C). Consistent with our yeast two-hybrid interaction and GST pulldown data, MNS1C localized to the MNS1 filaments, remarkably, to one end of the filaments, suggesting the polarity of the MNS1 filaments (Figure 6C). Interestingly, MNS1N also localized to one end of MNS1 filaments. In contrast, MNS1Δ localized continuously along the MNS1 filaments (Figure 6C), while GFP-MNS1Δ alone did not from aggregates (Figure S5). These data showed that all three MNS1 mutant proteins interact with the full-length MNS1 protein. Importantly, these data suggested that MNS1 filaments possess a polarity and that MNS1 may be assembled in a head to tail fashion.
Discussion
Here we report that MNS1 is essential for spermiogenesis but dispensable for meiosis. In a previous study, it was concluded that MNS1 is specifically expressed in pachytene spermatocytes [20]. However, we found that the MNS1 protein is abundantly expressed in late pachytene spermatocytes, diplotene spermatocytes, and spermatids and thus is not restricted to pachytene spermatocytes. Using different MNS1 antibodies that we generated, we always detected MNS1 as two closely migrating bands (∼60 kD) in protein extracts from testis, epididymal sperm, and trachea. Our antibodies were specific for MNS1, as evidenced by the absence of two ∼60 kD bands in MNS1-deficient testes, sperm, and trachea. However, in the previous study, the “MNS1” antibody recognized only one 60 kD band in testes and did not recognize any 60 kD protein in epididymal sperm by Western blotting analyses, raising the possibility that the antibody generated in that study might not be specific to MNS1 [20].
Several lines of evidence support that MNS1 plays an essential role in the assembly of sperm flagella. Firstly, MNS1 is an integral component of sperm flagella. The localization of MNS1 to SDS-treated sperm flagella suggests that MNS1 is an SDS-resistant component of sperm flagella. Secondly, MNS1 monomers interact with each other and are able to form fibrous polymers when ectopically expressed, implying that MNS1 might be assembled into filamentous structures in the flagella. Thirdly, in the absence of MNS1, sperm flagella are very short. Microtubules and ODFs are completely disorganized in the mutant sperm.
Inactivation of MEIG1, PACRG, or SPEF2 causes disorganization of microtubules and ODFs in sperm flagella, a phenotype similar to that in MNS1-deficient mice [27]–[30]. MEIG1 and PACRG interact with each other and both are expressed in spermatids [27], [29]. PACRG localizes to the postacrosomal region of the sperm head and the midpiece of the flagellum [29]. Disruption of SPEF2 by a LINE1 retrotransposon insertion in boars and inactivation of SPEF2 in mice led to immotile short-tail sperm defect [10], [31]. However, our yeast two-hybrid screen using MNS1 as bait did not detect any of these proteins. A proteomic screen has identified ∼50 proteins, including MNS1, from the accessory structures of mouse sperm flagellum [22]. These genetic and proteomic studies underscore the complexity in the structure and assembly of sperm flagella.
Based on the NCBI database search, MNS1 is conserved only in organisms with motile cilia. According to the ciliome database [5], MNS1 homologues were identified in a number of genomic and proteomic studies of ciliary proteins, for example, in Chlamydomonas reinhardtii [32]–[34], C. elegans [35], [36], and in humans [26], [37]. Therefore, in addition to male sterility, MNS1-deficient mice exhibit situs inversus and hydrocephalus, suggesting an essential role for MNS1 in motile cilia function and implicating MNS1 in primary ciliary dyskinesia (PCD). Interestingly, MNS1-deficient tracheal motile cilia lack some outer dynein arms, suggesting that MNS1 is an axonemal protein in the motile cilia. A number of genes are implicated in human, dog, and mouse PCD, including DNAI1 [13], DNAH11 [17], DNAH5 [18], [19], TXNDC3 [38], Spag6 [9], Pcdp1 [16], CCDC39 [15], CCDC40 [14], Spef2 [10], etc. However, MNS1-deficient mice grew to adulthood, suggesting that hydrocephalus is relatively mild in these mutant mice. Therefore, our study of MNS1 has important implications for male infertility in humans. Our findings on the function of MNS1 from mouse studies will help to select a cohort of infertile men with defined phenotypes for mutation screening in the human MNS1 gene.
Materials and Methods
Ethics Statement
Mice were maintained and used for experimentation according to the guidelines of the Institutional Animal Care and Use Committee of the University of Pennsylvania.
Generation of MNS1 Antibodies
Two GST-mouse MNS1 (amino acids 1–233 and 392–491) fusion proteins were expressed in Escherichia coli using the pGEX4T-1 vector and affinity purified with glutathione Sepharose. Purified recombinant proteins were used to immunize rabbits at Cocalico Biologicals Inc, resulting in MNS1 antiserum UP2060 against GST-MNS1 (aa 1–233) and UP2284 against GST-MNS1 (aa 392–491). Specific antibodies were affinity purified with the immunoblot method as previously described [39].
SDS-EDTA Treatment of Sperm and Western Blot Analysis
The epididymal sperm were collected from 3 male mice (C57BL/6) by squeezing the caudal epididymides in 1xPBS solution and centrifugation at 800 g for 5 min at RT. Sperm were homogenized in 1 ml of SDS-EDTA solution (1% SDS, 75 mM NaCl, 24 mM EDTA, pH 6.0) and centrifuged at 5000 g for 30 min at RT. 100 µl of SDS-PAGE sample buffer (62.5 mM Tris, pH 6.8, 3% SDS, 10% glycerol, 5% β-mercaptoethanol, 0.02% bromophenol blue) was added to 100 µl of supernatant, while the pellet was resuspended in 200 µl of SDS-PAGE sample buffer. The samples were heated at 95°C for 10 min and 20 µl of each sample was used for western blot analysis.
Targeted Disruption of the Mns1 Gene
To generate the Mns1 targeting construct, DNA fragments were amplified by high-fidelity PCR using an Mns1 BAC clone (RP23-349N4) as template (Figure 2A). V6.5 ES cells were electroporated with linearized targeting construct (pUP101/ClaI). Screening of ES cells was described previously and revealed a targeting frequency of 11% [40]. Two homologously targeted ES cell clones (B6 and G5) were injected into B6C3F1 (Taconic) blastocysts. The Mns1 mutant allele was transmitted through the germline in chimeric mice derived from both clones. All offspring were genotyped by PCR. Wild-type allele (500 bp) was assayed by PCR with the primers GTCAGGAAGATCTACGAGGA and CCAGAAGTCTTGTGCCCTCT. The Mns1 knockout (300 bp) allele was assayed by PCR with the primers GTCAGTTTGCTGTTGTAGAGT and CCTACCGGTGGATGTGGAATGTGTG.
Yeast Two-Hybrid Screen and GST-Pulldown Assay
A pretransformed Mate & Plate human testis cDNA library (Clontech) was screened using the full-length human MNS1 cloned into pGBKT7 as bait. GST-pulldown experiments were performed as previously described [41].
Histology, Immunofluorescence, and Western Blot Analyses
For histology, testes were fixed in Bouin's solution and brains were fixed in 4% PFA overnight. Samples were processed, sectioned, and stained with hematoxylin and eosin. For immunofluorescence analysis, testes were fixed in 4% PFA for 3 h at 4°C. Epididymal sperm and NIH 3T3 cells on slides were fixed with 4% PFA for 5 min at RT. Immunofluorescence was performed as previously described [42].
For Western blot analyses, adult tissues were homogenized in a glass homogenizer in SDS-PAGE sample buffer and heated at 95°C for 10 min. Protein concentration was measured using the Bradford assay. 30 µg of total protein for each sample was resolved on 10% SDS-PAGE gel and electro-blotted onto PVDF membrane. Primary antibodies used were MNS1 (this study), ODF2 (Santa Cruz), ACRV1 (P. P. Reddi) [43], Protamine 1 (SHAL) [44], β-tubulin (DSHB), ACTB (Sigma-Aldrich). Texas Red or FITC-conjugated secondary antibodies were used for immunofluorescence. HRP-conjugated secondary antibodies were used for Western blot analyses.
Electron Microscopy (EM)
EM was performed at the Biomedical Imaging Core facility at the University of Pennsylvania. Adult testes and dissected trachea were fixed in 2.5% glutaraldehyde and 2% paraformaldehyde overnight, and postfixed in 1% osmium tetroxide for 1 hour. The specimens were further processed and sectioned at the core facility as previously described [40].
Expression Constructs and Cell Culture
The cDNAs encoding full-length or truncated MNS1 were cloned into pcDNA3.1/V5-His TOPO TA for V5 tagging, or pEGFP-C1 for GFP fusion. Transfection of NIH 3T3 cells was performed using the Lipofectamine reagent (Invitrogen). 24–48 hours after transfection, cells were washed with PBS, fixed in PFA, stained with anti-V5 antibody (Invitrogen), incubated with secondary antibodies, mounted with DAPI-containing Vectashield mounting medium (Vector Labs) and visualized on a Zeiss Axioskop 40 microscope with a digital imaging system.
Supporting Information
Zdroje
1. SharpeRM 1993 Regulation of spermatogenesis. KnobilENeillJD The Physiology of Reproduction New York Raven Press 1363 1434
2. EddyEMO'BrienDA 1993 The spermatozoon. KnobilENeillJD The Physiology of Reproduction New York Raven Press 29 77
3. YanagimachiR 1993 Mammalian fertilization. KnobilENeillJD The physiology of reproduction New York Raven Press 189 317
4. ChemesHERaweVY 2010 The making of abnormal spermatozoa: Cellular and molecular mechanisms underlying pathological spermiogenesis. Cell Tissue Res 341 349 357
5. InglisPNBoroevichKALerouxMR 2006 Piecing together a ciliome. Trends Genet 22 491 500
6. FliegaufMBenzingTOmranH 2007 When cilia go bad: Cilia defects and ciliopathies. Nat Rev Mol Cell Biol 8 880 893
7. ZariwalaMAKnowlesMROmranH 2007 Genetic defects in ciliary structure and function. Annu Rev Physiol 69 423 450
8. Ibanez-TallonIPagenstecherAFliegaufMOlbrichHKispertA 2004 Dysfunction of axonemal dynein heavy chain Mdnah5 inhibits ependymal flow and reveals a novel mechanism for hydrocephalus formation. Hum Mol Genet 13 2133 2141
9. SapiroRKostetskiiIOlds-ClarkePGertonGLRadiceGL 2002 Male infertility, impaired sperm motility, and hydrocephalus in mice deficient in sperm-associated antigen 6. Mol Cell Biol 22 6298 6305
10. SironenAKotajaNMulhernHWyattTASissonJH 2011 Loss of SPEF2 function in mice results in spermatogenesis defects and primary ciliary dyskinesia. Biol Reprod 85 690 701
11. NonakaSShiratoriHSaijohYHamadaH 2002 Determination of left-right patterning of the mouse embryo by artificial nodal flow. Nature 418 96 99
12. McGrathJSomloSMakovaSTianXBruecknerM 2003 Two populations of node monocilia initiate left-right asymmetry in the mouse. Cell 114 61 73
13. PennarunGEscudierEChapelinCBridouxAMCacheuxV 1999 Loss-of-function mutations in a human gene related to chlamydomonas reinhardtii dynein IC78 result in primary ciliary dyskinesia. Am J Hum Genet 65 1508 1519
14. Becker-HeckAZohnIEOkabeNPollockALenhartKB 2011 The coiled-coil domain containing protein CCDC40 is essential for motile cilia function and left-right axis formation. Nat Genet 43 79 84
15. MerveilleACDavisEEBecker-HeckALegendreMAmiravI 2011 CCDC39 is required for assembly of inner dynein arms and the dynein regulatory complex and for normal ciliary motility in humans and dogs. Nat Genet 43 72 78
16. LeeLCampagnaDRPinkusJLMulhernHWyattTA 2008 Primary ciliary dyskinesia in mice lacking the novel ciliary protein Pcdp1. Mol Cell Biol 28 949 957
17. BartoloniLBlouinJLPanYGehrigCMaitiAK 2002 Mutations in the DNAH11 (axonemal heavy chain dynein type 11) gene cause one form of situs inversus totalis and most likely primary ciliary dyskinesia. Proc Natl Acad Sci U S A 99 10282 10286
18. Ibanez-TallonIGorokhovaSHeintzN 2002 Loss of function of axonemal dynein Mdnah5 causes primary ciliary dyskinesia and hydrocephalus. Hum Mol Genet 11 715 721
19. OlbrichHHaffnerKKispertAVolkelAVolzA 2002 Mutations in DNAH5 cause primary ciliary dyskinesia and randomization of left-right asymmetry. Nat Genet 30 143 144
20. FurukawaKInagakiHNarugeTTabataSTomidaT 1994 cDNA cloning and functional characterization of a meiosis-specific protein (MNS1) with apparent nuclear association. Chromosome Res 2 99 113
21. CarreraAMoosJNingXPGertonGLTesarikJ 1996 Regulation of protein tyrosine phosphorylation in human sperm by a calcium/calmodulin-dependent mechanism: Identification of A kinase anchor proteins as major substrates for tyrosine phosphorylation. Dev Biol 180 284 296
22. CaoWGertonGLMossSB 2006 Proteomic profiling of accessory structures from the mouse sperm flagellum. Mol Cell Proteomics 5 801 810
23. CarreraAGertonGLMossSB 1994 The major fibrous sheath polypeptide of mouse sperm: Structural and functional similarities to the A-kinase anchoring proteins. Dev Biol 165 272 284
24. HuangfuDLiuARakemanASMurciaNSNiswanderL 2003 Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature 426 83 87
25. GerminoGG 2005 Linking cilia to wnts. Nat Genet 37 455 457
26. OstrowskiLEBlackburnKRaddeKMMoyerMBSchlatzerDM 2002 A proteomic analysis of human cilia: Identification of novel components. Mol Cell Proteomics 1 451 465
27. ZhangZShenXGudeDRWilkinsonBMJusticeMJ 2009 MEIG1 is essential for spermiogenesis in mice. Proc Natl Acad Sci U S A 106 17055 17060
28. SalzbergYEldarTKarminskyODItachSBPietrokovskiS 2010 Meig1 deficiency causes a severe defect in mouse spermatogenesis. Dev Biol 338 158 167
29. LorenzettiDBishopCEJusticeMJ 2004 Deletion of the parkin coregulated gene causes male sterility in the quaking(viable) mouse mutant. Proc Natl Acad Sci U S A 101 8402 8407
30. BennettWIGallAMSouthardJLSidmanRL 1971 Abnormal spermiogenesis in quaking, a myelin-deficient mutant mouse. Biol Reprod 5 30 58
31. SironenAThomsenBAnderssonMAholaVVilkkiJ 2006 An intronic insertion in KPL2 results in aberrant splicing and causes the immotile short-tail sperm defect in the pig. Proc Natl Acad Sci U S A 103 5006 5011
32. PazourGJAgrinNLeszykJWitmanGB 2005 Proteomic analysis of a eukaryotic cilium. J Cell Biol 170 103 113
33. StolcVSamantaMPTongprasitWMarshallWF 2005 Genome-wide transcriptional analysis of flagellar regeneration in chlamydomonas reinhardtii identifies orthologs of ciliary disease genes. Proc Natl Acad Sci U S A 102 3703 3707
34. LiJBGerdesJMHaycraftCJFanYTeslovichTM 2004 Comparative genomics identifies a flagellar and basal body proteome that includes the BBS5 human disease gene. Cell 117 541 552
35. EfimenkoEBubbKMakHYHolzmanTLerouxMR 2005 Analysis of xbx genes in C. elegans. Development 132 1923 1934
36. BlacqueOEPerensEABoroevichKAInglisPNLiC 2005 Functional genomics of the cilium, a sensory organelle. Curr Biol 15 935 941
37. RossAJDaileyLABrightonLEDevlinRB 2007 Transcriptional profiling of mucociliary differentiation in human airway epithelial cells. Am J Respir Cell Mol Biol 37 169 185
38. DuriezBDuquesnoyPEscudierEBridouxAMEscalierD 2007 A common variant in combination with a nonsense mutation in a member of the thioredoxin family causes primary ciliary dyskinesia. Proc Natl Acad Sci U S A 104 3336 3341
39. HarlowELaneD 1998 Using antibodies: A laboratory manual Cold Spring Harbor Cold Spring Harbor Laboratory Press
40. YangFDe La FuenteRLeuNABaumannCMcLaughlinKJ 2006 Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. J Cell Biol 173 497 507
41. PanJGoodheartMChumaSNakatsujiNPageDC 2005 RNF17, a component of the mammalian germ cell nuage, is essential for spermiogenesis. Development 132 4029 4039
42. ZhouJPanJEckardtSLeuNAMcLaughlinKJ 2011 Nxf3 is expressed in sertoli cells, but is dispensable for spermatogenesis. Mol Reprod Dev 78 241 249
43. ReddiPPNaaby-HansenSAguolnikITsaiJYSilverLM 1995 Complementary deoxyribonucleic acid cloning and characterization of mSP-10: The mouse homologue of human acrosomal protein SP-10. Biol Reprod 53 873 881
44. StankerLHWyrobekABalhornR 1987 Monoclonal antibodies to human protamines. Hybridoma 6 293 303
Štítky
Genetika Reprodukční medicínaČlánek vyšel v časopise
PLOS Genetics
2012 Číslo 3
- Srdeční frekvence embrya může být faktorem užitečným v předpovídání výsledku IVF
- Souvislost haplotypu M2 genu pro annexin A5 s opakovanými reprodukčními ztrátami
- Mateřský haplotyp KIR ovlivňuje porodnost živých dětí po transferu dvou embryí v rámci fertilizace in vitro u pacientek s opakujícími se samovolnými potraty nebo poruchami implantace
- Primární hyperoxalurie – aktuální možnosti diagnostiky a léčby
- Příjem alkoholu a menstruační cyklus
Nejčtenější v tomto čísle
- PIF4–Mediated Activation of Expression Integrates Temperature into the Auxin Pathway in Regulating Hypocotyl Growth
- Metabolic Profiling of a Mapping Population Exposes New Insights in the Regulation of Seed Metabolism and Seed, Fruit, and Plant Relations
- A Splice Site Variant in the Bovine Gene Compromises Growth and Regulation of the Inflammatory Response
- Comprehensive Research Synopsis and Systematic Meta-Analyses in Parkinson's Disease Genetics: The PDGene Database