-
Články
- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Kariéra
Doporučené pozice
Reklama- Praxe
The haplolethality paradox of the wupA gene in Drosophila
Authors: Sergio Casas-Tintó aff001; Alberto Ferrús aff001
Authors place of work: Instituto Cajal, Consejo Superior de Investigaciones Científicas, Madrid, Spain aff001
Published in the journal: The haplolethality paradox of the wupA gene in Drosophila. PLoS Genet 17(3): e1009108. doi:10.1371/journal.pgen.1009108
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1009108Summary
Haplolethals (HL) are regions of diploid genomes that in one dose are fatal for the organism. Their biological meaning is obscure because heterozygous loss-of-function mutations result in dominant lethality (DL) and, consequently, should be under strong negative selection. We report an in depth study of the HL associated to the gene wings up A (wupA). It encodes 13 transcripts (A-M) that yield 11 protein isoforms (A-K) of Troponin I (TnI). They are functionally diverse in their control of muscle contraction, cell polarity and cell proliferation. Isoform K transfers to the nucleus where it increases transcription of the cell proliferation related genes CDK2, CDK4, Rap and Rab5. The nuclear translocation of isoform K is prevented by the co-expression of A or B isoforms, which illustrates isoform interactions. The corresponding DL mutations are, either DNA rearrangements clustered towards the gene 3’ end, thus affecting the genomic organization of all transcripts, or CRISPR-induced mutations in one of the two ATG sites which eliminate a subset of wupA products. The joint elimination of isoforms C, F, G and H, however, do not cause DL phenotypes. Genetically driven expression of single isoforms rescue neither DL nor any of the mutants known in the gene, suggesting that normal function requires properly regulated expression of specific combinations, rather than single, TnI isoforms. We conclude that the wupA associated HL results from the combined haploinsufficiency of a large set of TnI isoforms. The qualitative and quantitative normal expression of which, requires the chromosomal integrity of the wupA genomic region. Since all fly TnI isoforms are encoded in the same gene, its HL condition becomes unavoidable. These wupA features are comparable to those of dpp, the only other HL studied to some extent, and reveal a scenario of strict dosage dependence with implications for gene expression regulation and splitting.
Keywords:
Cell proliferation – DNA transcription – Drosophila melanogaster – Gene regulation – Genomics – Heterozygosity – Invertebrate genomics – Point mutation
Introduction
Diploid organisms are endowed with two genomic copies inherited from the parental generation. The gain or loss of small fragments from one or both of these genomic copies is referred to as segmental aneuploidies. When a single fragment is lost and the remaining copy is insufficient for normal biology, thus causing a phenotype, the segmental aneuploidy is referred to as haploinsufficient. In humans, haploinsufficient regions affecting to over 300 genes [1] are often associated to pathologies [e.g.: Parkinson’s disease [2]; bone marrow syndromes or myeloid malignancies [3] and autoimmune disorders [4], among others]. More rarely, haploinsufficiency may result in physiological advantages. In S. cerevisiae, a segmental haploidy increases stress resistance and ethanol production [5]. Interestingly, 3% of its 5900 genes are haploinsufficient when growing in enriched medium. The effect, however, can be alleviated by growing in minimal medium which suggests that the haploinsufficiency is due to low protein production [6]. Noticeably, 120 genes have never been recovered as deletions, suggesting that the absence of one copy of these genes may be lethal in the diploid phase of yeast [7]. Isolating such deletions is only feasible in diploid organisms by using suitable deficiencies and duplications. These regions are properly named as haplolethals (HL). Contrary to haploinsufficient regions, HL is a class of segmental aneuploidy whose nature remains largely unexplored due to the inherent difficulties to study them.
To justify a study on HL functions one should question how general HLs are? In the mouse, one HL function was identified by inducing segmental haploidy in ES cells followed by their injection in blastocysts. It was ascribed to the t-complex gene [8–10]. The HL function was assigned to a 3Mb region which includes several genes and, consequently, the correspondence with one or several genes was not unequivocally established. However, two other murine HL functions, also generated by treated ES cells, could be associated to the Vegf [11] and Tcof1 [12] genes. Based on theoretical considerations, HL functions in the mouse are estimated as more likely to occur than haploinsufficient ones (see figure 6 in [1]). In humans, about 1% of all pregnancies include some form of deviation from normal diploidy [13], and chromosomal deletions of embryonic malformations data revealed that about 11% of the genome has never been recovered in the haploid condition or any other copy number variation [14–17]. Although small deletions in human genomes are recognized as largely underestimated [18], segmental aneuploidies have been detected in oocytes, 10.4%, raising to 24.3% by three days of embryogenesis, and declining to 15.6% in preimplantation blastocysts [19]. Thus, human genomes reveal their developmental instability, from meiosis to adulthood and, consequently, the need for continuous selection against aneuploidies. These observations could be taken as indirect evidence for deleterious HL functions in humans and its strong negative selection.
In Drosophila, the seminal work by the groups of Lindsley and Sandler in 1972 [20], based on segmental aneuploidies covering 85% of its genome, provided the first estimation of HL regions, up to 20, one of them being haplo-, as well as, triplo-lethal (Tpl). Since organism survival is inversely proportional to the extent of the genetic material deleted, the HL condition could result from the additive insufficiency of several adjacent genes. Thus, the estimated number of HL regions in flies has been reduced when smaller deletions have become available. A recent study of 793 small deletions covering 98.4% of the Drosophila genome indicates the number of HL regions as 5, including the Tpl [21]. The difficulty to study HL functions has precluded linking HL regions to specific genes, with only two exceptions. The decapentaplegic (dpp) gene includes an HL region which was functionally dissected from a recessive lethal phenotype using specific DNA fragments as transposons [22]. The HL region of dpp is referred to as Hin (haploinsufficient) in the corresponding literature. It spans 8 kb and it is thought to affect the five dpp transcripts. This Hin region seems refractory to insertions of the P type, but not to hobo type, transposons. Interestingly, the two 13 kb hobo inserts in the Hin region of dpp that had been reported, one of them landed in an intron, and the other did it in the 3’ untranslated region of exon 3 [23]. Thus, the dpp associated haplolethality is currently understood as a dosage insufficiency of the single encoded protein, the morphogen DPP a.k.a. BMP in vertebrates. Being the only HL region studied in Drosophila so far, we cannot evaluate how general the relationship between dosage insufficiency and haplolethality is. This issue is particularly relevant because Drosophila and most other genomes studied in some depth show a wide tolerance to dosage changes by means of transcriptional changes in functionally related genes outside the deleted region [24]. This effect is thought to reflect the robustness of genome networks [25]. This dosage tolerance renders even more intriguing the existence of haplolethals.
The wings-up A (wupA) gene is related to another HL region located at chromosome band 16F7 [26]. A haplolethal region implies the existence of dominant lethal loss-of-function mutations. Intriguingly, the mutational analysis of the region searching for the expected dominant lethal mutants (DL), had provided chromosomal rearrangements only, rather than point mutations, and all of them turn out to be located towards the 3’ end of the wupA transcription unit [27]. Remarkably, the Tpl region has proven also refractory to point mutations and only rearrangements were obtained [28]. Since the duplication required to isolate DL mutants in the 16F7 region, Dp(1;3R)JC153, also contains genes adjacent to wupA, the HL function could result from the combined insufficiency of several genes under the control of regulatory sequences located inside the wupA gene or, alternatively, from the haploinsufficiency of the wupA encoded protein, Troponin I (TnI). Although we have previously analyzed the biology of TnI beyond the muscle cells [27,29–33], we address here the functional specificity of its various isoforms with the aim of unraveling the genetic nature of the associated HL.
Results
This study deals mainly with the HL function located at the Drosophila chromosome band 16F7 where the gene wupA is located. Although the original data are available in previous reports [26,30,34], we summarize here the mutational analysis of wupA to facilitate reading this report and accommodate the novel data. Four categories of wupA mutations can be identified (Fig 1). Described from proximal to distal with respect to the centromere, the mutations are classified as Recessive lethals (RL), Semidominant lethals (SDL), Dominant lethals (DL) and Viables (V). The types RL, SDL and DL are discriminated by the viability of heterozygous females, 100% in RL, under 50% in SDL, and 0% in DL. While V mutations are single nucleotide changes, the RL, SDL and DL types are all chromosomal rearrangements. The transcriptional products from wupA result in two ATG translation sites (black and white boxes in Fig 2) yielding 13 different transcripts, A-M, which are shown letter-coded in Fig 2. Black transcripts K, L and M yield the same protein isoform, which reduces the total number of TnI isoforms to 11.
Fig. 1. Physical map of the known mutations in the wupA gene. Fig. 2. Transcriptional isoforms from wupA and adjacent genes. The diagram shows the 13 letter-coded transcripts emerging from the two ATG sites (white and black boxes). Note that the three black transcripts (K, L and M) share the same coding exons, thus, the gene yields 11 TnI protein isoforms. Data are available in FlyBase. Centromere is to the right. Note the proximal location of lncCR45605, lncCR45606 and mir-969 genes whose putative functional relationship with wupA is discussed in the main text. The normal HL function at 16F requires the integrity of the wupA genomic region
Over the years, a number of duplicated genomic fragments of the wupA region have become available (Fig 3). In order to establish a link between the HL function and genes in the region, each duplicated fragment was tested against all available mutants in wupA and adjacent genes, in particular all known DL mutants. Black fragments indicate rescue of DL and wupA mutants, and white ones indicate failure to do so. Duplication 3 [Dp3 = Dp(1,3R) JC153] is the largest fragment (>600 kb) and, as expected, it fully rescues all DL and the rest of wupA mutants. Duplication 1 [Dp1 = Dp(1;2R) CH322-143G12r], a pBAC with which we obtained a transgenic line, also rescues all wupA mutants. Duplication 2 [Dp2 = Dp(1;3) wupA-2XTY1-sGFP-V5-preTEV-BLRP-3XFLAG] is a fosmid construct [35]. Particularly relevant is the result that the combination of genomic fragments E6L plus Dp (1;2L) CH322-61E02r is still unable to rescue DL mutants even though it encompasses the entire wupA transcription unit, (albeit not in a continuous sequence) (Fig 3). If a regulatory sequence would be contained within the wupA transcription unit, it would not be able to operate in trans. Thus, the normal HL function at 16F7 requires the linear (cis) integrity of the wupA gene. In addition, the fact that ♀ DL/RL; Dp2/+ is lethal, but ♀DL/RL; Dp2/Dp2 is not, demonstrates that the RL and DL functions are functionally related and that they are dosage dependent on the products supplied by Dp2 (see foot notes in Table 1).
Fig. 3. Functional map of duplicated chromosomal fragments of the wupA region. Tab. 1. Rescue by duplications. The adjacent location of mir-969 (http://flybase.org/cgi-bin/gbrowse2/dmel/?Search=1;name=FBgn0283471) to wupA and its inclusion in Dp1, a duplication that rescues all the DL mutants (Fig 3 and Table 1), invited to explore its potential role in our HL function. Thus, mir969 was expressed under the general driver tub-Gal4LL7 in normal, RL l(1)23437 and V hdp3 backgrounds. In the first case, the overexpression of mir969 throughout the body did not yield a visible phenotype. In the other two backgrounds, it failed to rescue or modify the phenotypes of either of these wupA mutations. Likewise, the depletion of mir969 by means of expressing the construct UAS-mCherry-mir969-sponge in either of these three backgrounds, also failed to modify the l(1)23437RL and hdp3 phenotypes nor to cause a DL condition. Most relevant, it should be noted that Dp2, which rescues the DL mutants, does not contain mir-969 (Fig 3). Thus, we can conclude that mir969 does not show evidences to suspect a functional interaction with wupA or its associated HL function. An equivalent reasoning allows excluding the other adjacent genes, CG7135 and Taf8, since the genomic fragment E6L does not rescue any of the wupA mutants, while it does for Taf8 ones (Fig 3).
Between mir-969 and wupA, two additional genes have been identified recently which encode long-non-coding RNAs, lnc45605 and lnc45606 (Fig 2). Their lnc nature invites to consider their possible regulatory activity upon wupA. According to the physical data available, both of them are included within the three duplications, Dp1, Dp2 and Dp3, which rescue DL mutants (Figs 2 and 3). However, both lnc genes are also included in Dp(1,2L)CH322-61E02r which does not rescue any of the known wupA mutants. In addition, a deficiency that deletes both lnc genes, Df(1)BSC352, does not cause a DL condition (S1 Fig). Nevertheless, given the proposed regulatory activity of lnc genes in general [36], we tested this possibility by means of a gene complementation assay in females heterozygous for Df(1)BSC352 over RL and V type wupA mutants (S2 Fig). Df(1)BSC352 fails to complement the RL mutants, l(1)23437, PL87 and PG31, and this lethality is rescued by Dp1, Dp2 or Dp3. The RL mutants are rearrangements (Fig 1) that alter the structure of the URE regulatory region of wupA [31], and this could justify the lack of complementation by Df(1)BSC352. However, that deficiency complements the V type mutants hdp2 and hdp3, while the RL mutants do not. The differential complementation of wupA mutants could indicate that Df(1)BSC352 deletes selected regulatory elements of wupA expression, including lnc45605 and lnc45606, while leaving others intact. Actually, enhancers corresponding to the IRE region [31] are not deleted in Df(1)BSC352. In the absence of genetic tools that could allow a more thorough functional analysis of these lnc genes, we must consider their putative role on wupA regulation as still open. If future experiments would proof that role, it is clear already that lnc haploinsufficiency is independent from haplolethality because the heterozygous Df(1)BSC352/+ is not DL (see Discussion).
In addition to the HL functions linked to wupA and dpp genes, there are other genomic regions for which the deletion analysis indicates HL conditions. We explored the possible interaction between the wupA HL and the rest of the putative HL functions, excluding the Tpl region due to the lack of suitable genetic tools (S1 Table). We tested genotypes carrying a DL mutant at wupA and duplications that rescue the other reported HL regions [37,38]. Likewise, we tested deficiencies that uncover these other HL regions with duplications that cover wupA. None of these combinations modified the corresponding HL phenotypes. Thus, we conclude that there is no evidence, at this point, to suggest a functional link among HL functions within the Drosophila genome. They do share, however, the coding of multiple transcripts and, in the known cases of dpp and wupA, the corresponding DL mutants are rearrangements broken in non-coding sequences which affect most, if not all, gene transcripts. Is the biology of HL genes substantially different from that of non-HL counterparts?
Single transcripts from wupA rescue neither DL nor wupA mutants
UAS constructs were generated for each wupA transcript and tested with the general driver tub-Gal4LL7 in order to assay if the overexpression of any of them would rescue mutants located in this gene. The data show (Table 2) that none of the white transcripts, nor the single black one tested, rescue any of the wupA mutant types including the DL type. The rescue of hdp3 by isoforms B and E is partial since they restore wing position, albeit not flight, in about 25% of adults only. At least two different transgenic insert lines were tested per UAS construct.
Tab. 2. RESCUE OF wupA MUTANTS. We also tested three relevant genomic duplications with the same set of wupA mutants in order to compare with the results obtained with the UAS constructs (Table 2). Duplication 2 yielded interesting rescue effects. It shows dose dependence in the rescue of DL mutants. One copy of Dp2 is sufficient to rescue DL/+ heterozygous females, while two copies are needed to barely rescue DL/DL homozygous adult females. Two copies are also needed to rescue DL males (see footnotes in Table 2). Another interesting feature of Dp2 is its failure to rescue the V type mutants hdp3 and hdp2. This last result demonstrates that Dp2, although able to rescue DL mutants, does not supply the full set of normal functions for wupA. To a lesser extent, Dp1 also show insufficient supply of normal wupA function since two copies can yield only 1% of adult DL/DL female escapers while one copy is sufficient to rescue wing position in hdp alleles (Table 1).
Since two of the duplications, Dp1 and Dp2, showed differential rescue effects with respect to Dp3, this feature invited to analyze the transcriptional properties of these inefficient duplications. To that end, we used qRT-PCR to measure the transcriptional yield of adult males with Dp1 and Dp2 in l(1)23437 and hdp3 backgrounds. These backgrounds and the designed exon specific probes facilitated the identification of wupA transcripts to the extent possible (Fig 4). In the l(1)23437 background (Fig 4A and 4D), the heterogeneity in the relative levels of the various transcripts, either in the presence of one or two copies of Dp2 or in combination with Dp1, becomes evident. In the hdp3 background (Fig 4E–4G), the phenomenon of quantitative transcriptional heterogeneity is also detected. Even the point mutation hdp3 that, altering the splice site for exon 6d should have affected the C, F, G and H red transcripts only, yields overexpression of white A, J, and black K, L and M products (Fig 4E). Neither Dp1 nor Dp2 can normalize this hdp3 caused overexpression. These transcriptional data uncover a fine quantitative regulation of the wupA transcriptional expression that was unsuspected hitherto. Not only the genomic duplications do not provide the expected levels of transcripts, but also a splice site mutation as hdp3 seems to alter the expression of transcripts that do not include the affected exon, 6d. In addition, these data also suggest that the wupA encoded products, isoforms of Troponin I (TnI), may not be functionally equivalent.
Fig. 4. Transcriptional effects of duplications Dp1 and Dp2 covering wupA region. A-D) Effects on l(1)23437 background. The wupA products interact and are functionally diverse
In a previous study we had shown that the attenuation of wupA expression by means of RNAi or its overexpression using the TnI overexpressing construct PBac(WH)f06492 yield noticeable effects on cell proliferation [33]. This overexpression is synergistic with standard oncogenes such as Rasv12, Notch or lgl, while its attenuation largely suppresses their tumor overgrowths. Following the generation of UAS constructs for single wupA transcripts, we analyzed the effects of their individual overexpression in order to determine if all TnI isoforms play similar functions in cell proliferation or if, by contrast, they show functional specificities.
To that end, we generated somatic clones in larval wing discs and quantitated clone size with respect to wing disks of sibling controls expressing an innocuous UAS construct (Fig 5A). The data reveal at least three different phenotypic effects on cell proliferation: 1) No effect (transcript A), 2) Underproliferation to various degrees (transcripts B-J), and 3) Overproliferation (transcript K). Thus, different TnI isoforms affect cell proliferation and/or survival in different ways. While most isoforms reduce cell proliferation, isoform K causes a strong proliferative effect when overexpressed. Since the three black transcripts K, L and M encode the same protein, testing only one of them is justified.
Fig. 5. TnI isoforms are functionally different and interacting. A) Cell proliferation effects of single TnI isoforms overexpression. Somatic clones were induced in the larval wing discs (genotype: ♀♂ hsFlp; act-FRT-yellow-FRT-Gal4/+; UAS-TnIisoformX/+) screened 48h after heat shock (48AHS). Note that, with the exception of A, all white isoforms reduce cell proliferation. By contrast, the black isoform tested (K), yields a significant proliferation increase. Since all black isoforms (K, L and M) yield the same protein, only one was tested. B-E) Nuclear localization of isoform K. B) Images of larval wing disc somatic clones expressing the HA-tagged K isoform (red) and the cell reporter GFP to identify the clones. Nuclei are stained by DAPI (blue). C) Equivalent clones in the salivary glands and D) the neuroblast descendants in the central nervous system. E) Lower row of panels show one salivary gland nucleus stained for DAPI (blue) and TnI (red). Note the nuclear localization of K-HA, mostly in the periphery. F-J) The nuclear localization of isoform K is interfered by isoforms A or B. Equivalent clones co-expressing TnI isoforms K-HA and A or B in wing imaginal discs (F, G) or salivary glands (H-J). The nuclear localization of isoform K is efficiently prevented by isoform A and, to a higher extent, by isoform B. Also in a previous study, we showed by immunodetection that TnI traffics to the cell nucleus as a function of cell cycle status [32]. Since isoform K causes overproliferation and we had shown previously that the generalized overexpression of wupA triggers overexpression of cell division related genes [33], we investigated if isoform K, by itself, could have the capacity to translocate to the nucleus and trigger transcriptional changes in cell proliferation related genes. To that end, we created an HA-tagged version of isoform K and expressed it in wing disc somatic clones, salivary glands and neuroblasts. The HA tag is detected in the nucleus in all three cell types (Fig 5B–5E). Benefiting from the large size of salivary gland nuclei, the HA-K signal can be clearly identified in the periphery of the nucleus (Fig 5E). This localization of isoform K is consistent with the immune detection that we reported using a polyclonal TnI antibody (see figure 1 in [39]).
In addition, we tested the eventual changes in the expression of a set of genes involved in the control of cell proliferation by qRT-PCR (S3 Fig). We used RNA from larvae overexpressing isoform K (genotype: tub-Gal4LL7 > UAS-K). Consistent with our previous study, a subset of these genes are overexpressed when the isoform K is in excess. In particular, CDK2, CDK4, Rap and Rab5 exhibited significant overexpression with respect to controls (genotype: tub-Gal4LL7 > UAS-LacZ). CD2 and CDK4 are well known inducers of cell cycle entry [40]. For example, CDK2 mediates Myc induced cell proliferation through its association with Cyclin E [41,42], while CDK4 plays equivalent roles through its association with Cyclin D [43,44]. Likewise, Rap, a Fizzy-related protein, regulates cell proliferation [45], and Rab5 contributes to proliferative cell signaling through the titration of EGFR [46], among other functions.
Given the strong effect of isoform K on cell proliferation (Fig 5A) and its nuclear localization, we questioned if its generalized overexpression could yield a visible phenotype. Two constructs were tested, HA-K and non-tagged K, driven by tub-Gal4LL7. In both cases, the genotype was adult lethal. Other drivers with more restricted domains of expression, en-Gal4 and rn-Gal4, yielded poorly viable adults (<10%) with various morphological abnormalities in wings and legs (S4 Fig). Thus, we conclude that isoform K overexpression is deleterious.
In view of the diversity of TnI effects on cell proliferation (Fig 5A), we questioned if the function of a given transcript could be modified by others from the same gene. As an example, we chose the nuclear localization of the K isoform (black) under the co-expression of white isoforms. Thus, we generated somatic clones expressing HA-K along with A or B isoforms. The data show that both white isoforms prevent the nuclear localization of K in imaginal discs and salivary glands, being the A effect weaker than that of B (Fig 5F–5J). To further investigate possible additional examples of isoform interference, we tested the adult lethality caused by the excess of K (genotype: tub-Gal4LL7 > K), but generated from females heterozygous for the RL mutant l(1)23437. In this case, the overexpression of K is no longer lethal and females l(1)23437/+; tub-Gal4LL7/K are 100% viable. This result suggests that the relative depletion of TnI isoforms caused by the 23437 mutant in the maternal oogenesis or early embryogenesis could alleviate the deleterious overexpression of isoform K. The suppression of the lethality due to K excess is also observed when the maternal progenitor is heterozygous for other RL mutants, PL87 and PG31. The V mutants hdp3 and hdp2 also suppress the K-dependent lethality, always when the RL or V mutants come from maternal, not paternal, origin. As shown above (Fig 4E), hdp3 eliminates isoforms C, F, G and H, and hdp2 is a point mutation in a constitutive exon (Fig 1). On the other hand, the co-overexpression of K with isoforms B or A maintains the lethality. Finally, as shown in Table 2, isoforms B or E can rescue, to some extent, the wings up phenotype of hdp3. That is, the depletion of C, F, G and H isoforms can be compensated, at least in part, by the excess of B or E (see foot note in Table 2).
Beyond these in vivo phenotypes, we investigated the transcriptional effects of overexpressing specific TnI isoforms. The rationale being that, if there is phenotypic interference among isoforms, there could be transcriptional interference also (Fig 6). The data show that the overexpression of isoform A (Fig 6A), in addition to yield its own excess, as revealed by probe 6a, it also causes excess of probe 6c detected isoforms, E, D and I. Surprisingly, driving isoform B (Fig 6B), yields a significant excess of most other isoforms except of itself. This paradoxical result could indicate, perhaps, a regulatory effect of isoform B on wupA transcription but the issue was not investigated further. The equivalent experiment driving isoform K (Fig 6C) seems to be rather specific for that isoform as revealed by probe 6a. The transcriptional effect was also reproduced by driving the HA-tagged version of isoform K (S5 Fig). Finally, we included in this set of experiments the transcriptional effects of the PBac(WH)f06492 since this UAS-dependent construct had been shown to cause strong proliferation effects synergic with standard oncogenes [32], as mentioned above. The data show (Fig 6D) that this construct elicits the strong overexpression of 6a revealed isoforms, which include isoform K, and, to a lesser extent, the 6c detected isoforms. This transcriptional effect is consistent with the cell proliferative phenotype observed with isoform K overexpression (Fig 5A).
Fig. 6. Transcriptional effect of driving single TnI isoforms. Taken together, these experiments uncover a wide range of functional interactions among TnI isoforms operating throughout development and cell types. Presumably, the repertoire of interactions will extend beyond the cases experimentally analyzed here. Their large combinatorial number, however, precludes an exhaustive analysis at this time. It seems that the normal biology of the wupA gene consists of a collection of diverse, albeit interacting, functions achieved by the ensemble of encoded TnI isoforms. Likely, the expression of these isoforms will be subject to a tight quantitative regulation. Could a combined depletion of all or several TnI isoforms account for the HL function at 16F?
Targeting a subset of wupA products causes a DL phenotype
The functional diversity and interactions of TnI isoforms invited to consider their haploinsufficiency as the cause of the HL phenomenon. To address this possibility, we obtained a point mutation (A>C) at the white ATG site by means of the CRISPR/Cas9 system (see Materials and Methods and S6 Fig). Two independent mutations, 18230C and 18230B, were isolated and tested for their viability effects in combinations with DL, RL and V mutants and the same three genomic duplications used in previous experiments. The key data for allele 18320C, which was validated by sequencing, are shown in Table 3 and Fig 7.
Tab. 3. FUNCTIONAL PROPERTIES OF A Dominant Lethal MUTATION IN THE white ATG SITE OF wupA. Fig. 7. Transcriptional effects of the dominant lethal mutant allele 18320C. Genotypes are indicated below each histogram. Primers from exon 6d were used to monitor isoforms C, F, G and H. Transcriptional levels are normalized to sibling controls. Note that Dp2, either in one or two doses, although it rescues the dominant lethality of 18320C, denoted as DL for brevity, it does not supply the normal levels of 6d containing isoforms, 25% roughly. Also, since ♀ hdp3/hdp3; Dp2/+ and ♀ hdp3/18320C; Dp2/+ yield the same levels of these transcripts, it follows that 18320C is null for these isoforms. By extension, since 18320C is a point mutation in the white ATG site, this mutant should be also null for the rest of white TnI isoforms. Females heterozygous for 18230C show 0% viability, thus proving its DL condition. This lethality is rescued by the three genomic duplications, Dp1, 2 and 3, when tested in males. In homozygous females, however, Dp1 shows the same dosage dependence that Dp2 had shown in previous experiments (Table 2). The 18230C mutant, when confronted with regular DL mutants in heterozygous females, yields a lethality that neither Dp1 nor Dp2 can rescue. Actually, the large Dp3 yields a low rate of escapers only. By contrast, Dp3 does rescue 18230C when heterozygous over a RL mutant. These data prove that the DL, RL and 18230C mutants affect the same function(s) although, most likely, to a different degree. Also, the incomplete rescue by the duplications is consistent with their heterogeneous transcriptional yield shown above (Fig 4).
To determine that 18230C affects transcription of white isoforms, we carried out two experiments. On the one hand, adult females heterozygous for 18230C and hdp3, whose dominant lethality is rescued by Dp2, show the classical wings up phenotype (Table 3). On the other hand, the qRT-PCR assay of these flies (genotype: 18230C/hdp3; Dp2/+) shows depletion of exon 6d containing isoforms, C, F, G and H; confirming that 18230C eliminates these white isoforms (Fig 7). Choosing Dp2 for these experiments is justified because it is the only available duplication that does not cover hdp3 and, yet, provides enough normal wupA function as to rescue the dominant lethality. The quantitative transcriptional levels provided by Dp2 are consistent with the unusual dosage effects observed in the rescue experiments (Table 2). Either one or two copies of Dp2 fail to yield normal levels of the 6d revealed isoforms, C, F, G and H. Although it shows a clear dosage effect, two copies of Dp2 still transcribe below 50% of controls.
The data from the other allele, 18230B, were identical to those of 18230C. Targeting the black ATG site would have not been instructive because, being located downstream of the white ATG, the procedure to obtain mutations by CRISPR in this triplet would also affect the white isoforms; thus providing no additional information with respect to the other existing DL rearrangement mutants.
These data demonstrate that the elimination of the whole white subset of TnI isoforms is sufficient to cause a DL phenotype; thus, it seems that the HL function at 16F7 results from the haploinsufficiency of TnI proteins, at least those encoded by the white transcripts. Considering all available wupA mutants and genomic duplications studied here, a graded array of product depletion becomes evident (Fig 8). The most extreme is, obviously, the chromosomal deficiencies that uncover the region, and the DL rearrangements clustered at the 3’ end of the transcription unit. Following are the two 18230 mutants which also result in dominant lethality by eliminating the white isoforms only. The evidence that indicates that 18230 mutants are less severe than the regular DL mutants is shown in Table 3, where Dp3 can produce some escapers of the 18230C/DL genotype [♀18230C/18242DL; Dp3/+ or ♀18230B/18242DL; Dp3/+ or ♀18230C/13193DL; Dp3/+]. This Dp3, in one dose only, does not rescue DL/DL genotypes at all. Although not analyzed here, the next grade of depletion would be the SDL type of mutants, followed by the RL type. Finally, the hdp3 mutation eliminates the exon 6d containing isoforms only, C, F, G and H. Their depletion, however, is not enough to cause lethality. Concerning the genomic duplications, a similar graded array of normal functions can be identified. The large Dp3 is the most effective supplier of all normal functions, followed, in descending order, by Dp1 and Dp2. Although the three duplications can rescue all DL and wupA mutants in general, Dp2 does not rescue hdp3 nor hdp2 alleles. The graded scale for wupA is equivalent to that observed for dpp alleles [47] (see S7 Fig). See Discussion for other functional similarities between wupA and dpp.
Fig. 8. Graded scale of wupA mutant alleles. Schematic representation of the relative levels of wupA function in the corresponding mutant alleles and the duplications used in this study. In conclusion, the wupA gene encodes a number of TnI protein isoforms which show functional diversity and interactions. Their transcriptional expression is quantitatively regulated to the extent that their combined haploinsuficiency, at least all the white isoforms, causes haplolethality.
Discussion
Two major findings are reported here. A) TnI isoforms are functionally diverse and interacting, and B) This isoform repertoire is strongly dosage sensitive for organism viability to the extent of causing haplolethality.
Biology of TnI isoforms
TnI was once considered a muscle specific protein playing its role within the Troponin-Tropomyosin complex during contraction of the sarcomere [48]. Our previous studies demonstrated that TnI is also expressed in non-muscle cells and that, at least some protein isoforms, play a role in normal and tumorous cell proliferation and in apico-basal cell polarity [33,39]. Here, we analyzed the TnI isoforms separately, and found that their role in cell proliferation is diverse and, in some cases, opposed. This implies a wide network of functional interactions between TnI isoforms themselves and with other partners. When the coding sequence of wupA was first identified [29], the array of alternative and mutually exclusive set of exons 6 a-d pointed to the possibility of functional specialization of TnI isoforms. One of the structural differences that the four alternative exons 6 offer is the number of Cys residues in each isoform. Differences in this number could provide different interactions with other Cys containing partners. This possibility should be explored in future protein-protein interaction studies using single TnI isoforms as bait.
We had shown previously that, at least some, TnI isoforms can translocate to the cell nucleus [32] where they elicit transcriptional changes in cell proliferation related genes [33]. Here we show that isoform K, and presumably the sequence identical L and M isoforms, can translocate to the nucleus. The high levels of Actin in the cell nucleus and its role in chromosome motion and gene transcription [49–51] is consistent with the proposal that the transcriptional changes elicited by the nuclear TnI could be mediated by the interaction of Actin with one or several TnI isoforms, akin to the interactions that take place in the muscle sarcomere. In the context of this study, at least isoforms A and B interfere with the nuclear trafficking of K. This feature provides a putative mechanism to influence cell proliferation through the quantitative regulation of the ratio between white and black TnI isoforms according to the cell status or physiological requirements. Experiments to address this hypothesis should be designed under conditions that ensure the quantitative control of combinations of TnI isoforms. Such experiments, however, are beyond the scope of this study given the vast number of possible combinations.
Concerning the mutant effects on the wupA products, it could be proposed that the DL mutant rearrangements may yield truncated TnI isoforms which could cause extreme interference leading to dominant lethality. Actually, truncated TnI forms are associated to cardiac dysfunction in vertebrates. These, usually C-terminus, truncated forms result from proteolysis of native cardiac TnI, and serve as diagnosis of myocardial infarction or stunning [52,53]. One of the TnI cleaving enzymes corresponds to the ubiquitin ligase MuRF1 [54]. However, the trigger factor, hence the origin of the cardiac dysfunction, of this proteolysis remains unknown. One N-terminus truncated TnI fragment in mice is produced under normal physiology and it becomes upregulated under microgravity conditions, which suggests a role in cardiac muscle adaptation [55]. However, for wupA and its associated HL condition, several types of data render the proposal of DL mutants as deleterious truncated forms, unlikely. The most direct evidence against truncated wupA products is that they are not detected in Western blots of extracts from various genotypes which include RL, SDL and DL types of mutants, all of them rearrangements (S8 Fig). None of these genotypes yield immune-detected protein fragments smaller than TnI. In addition, although all DL mutants known hitherto are rearrangements clustered towards the 3’ end of wupA, in this study we have obtained two A>C mutant alleles in the white ATG site, 18320B and 18320C, which also result in DL type of mutants. The available experimental evidence suggests only one functional difference between the DL rearrangements and the DL point mutation in the white ATG; while the former could be nulls for all TnI isoforms, the latter are likely nulls for the white subset only. Admittedly, counterarguments could still be raised to defend the hypothetical truncated TnI products, for example their rapid degradation and, therefore, their difficulty to be detected in Western blots. Would that be the case, however, the short life of truncated products would imply an equally short lived poisonous effect. Thus, there is no evidence to support it at this time.
Regulation of wupA expression
The functional diversity of TnI isoforms implies the existence of regulatory mechanisms for proper expression in the normal biology of the cell. Previous to this study, we had identified two regulatory regions, URE and IRE, located at the 5’ terminus of wupA, based on the criteria of LacZ-reported expression of selected genomic fragments [31]. That criteria, however, is informative on positive enhancers, but repressors are missed. Here, we used qRT-PCR to discriminate among the various gene transcripts. The two genomic duplications analyzed, Dp1 and Dp2, although they rescue the DL mutants, the quantitative levels of transcripts they supply is heterogeneous with respect to the normal condition. This feature illustrates how superficial the evaluation of gene activity can be, if it is solely based on the resulting phenotype, adult viability in this case. Although these genomic duplications can restore viability of DL mutants, their transcription is far from being wild type. It is evident that the quantitatively normal levels of transcription require the proper chromatin landscape to an extent beyond the limits usually defined by a transcription unit. Additional supporting evidences can be found scattered in the scientific literature on other genes and organisms. However, these facts are largely unattended when experimenting with genomic fragments or, exceedingly so, when handling genetic constructs engineered with alien promoters and enhancers. The fact that none of the single isoforms rescue any of the known wupA mutants strongly suggests that the corresponding normal functions are achieved by combinations, rather than individual, isoforms acting in a specific stoichiometry. This is conceptually relevant because it underscores the combinatorial role of isoforms from a single gene, a subject often not considered in most studies.
The proximity and nature of mir-969, lnc45605 and lnc45606 genes invites to consider their possible regulatory role on wupA, and their contribution to the HL condition. In the case of mir-969, the feasible experimental data have failed to provide the required evidence. As for lnc45605 and lnc45606 the suitable genetic tools are not yet available. Thus, the issue of the regulatory mechanisms for wupA by means of additional genes remains open. Nevertheless, based on the facts that the heterozygous deletion for lnc45605 and lnc45606, Df(1)BSC352, does not cause DL, and that their duplication in Dp(1,2L)CH322-61E02r does not rescue DL mutants, we can draw the conservative conclusion that the putative regulatory role of these genes upon wupA is independent from haplolethality. Furthermore, the fact that the A>C mutants 18320B and 18320C cause DL phenotypes, demonstrates that dosage reduction of wupA is sufficient to explain the HL condition.
The standard nucleotide map of the upstream wupA region (Flybase) and the position of RL type mutants determined by Southern blots, can be used to estimate the distance between putative regulatory landmarks. Using the 5’ end initiation site of wupA as a reference (nucleotide 18,116,922), the proximal order and relative nucleotide positions of landmarks will be: PL87 (-30), distal break of Df(1)23437 (-100), PG31 (-249), distal break of Df(1)BSC352 (-545), proximal break of Df(1)23437 (-2100) and 3’ end of lnc45605 (-3624). The overlap between Df(1)BSC352 and Df(1)23437 explains their non-complementation for their recessive lethality. However, the same non-complementation with PG31 and PL87 may be attributed to polar effects during regional pairing caused by the different nature of the two rearrangements, deficiency and insertions, or to dysfunction of different sets of cis-acting regulatory regions in each chromosome. A regulatory role for one or both of the lnc genes, although it cannot be ruled out, seems unlikely. Over 3 Kb separate lnc45605 from wupA, and the Dp(1,2L)CH322-61E02r, which contains both lnc genes, does not rescue wupA mutants of any type. The later feature prevents to call even for a trans-acting regulatory role of lnc genes on wupA.
The case of hdp3 has unveiled another unexpected feature on quantitative control of wupA transcription. A single nucleotide mutation at the splicing acceptor site for exon 6d increases the expression of non-exon 6d containing transcripts. These results on transcriptional activity could indicate that the expression of wupA is subject to a feed-back control by its own encoded products, in addition to the two ATG sites, and by the duplicated regulatory 5’ regions, URE and IRE. At this time, however, this form of wupA regulation must be considered hypothetical.
Attending to the clustering of several DL mutant rearrangements, a regulatory structure in the interval between coordinates 1086.8 and 1086.9 towards the 3’ end of the gene could be proposed. The region corresponds to the intron between exons 7 and 8. Of note, the rearrangements leading to DL mutations have occurred in non-coding sequences in all HL associated genes known to date in flies and mice. This putative regulatory structure in wupA cannot operate in trans since the combination of the genomic fragments E6L plus Dp(1;2R) CH322-143G12r does not rescue DL mutants. Also, the URE and IRE regulatory regions cannot be the sole mechanism that regulates wupA expression because their structural alteration by means of deletions (l(1)23437) or insertions (PL87 and PG31), yield RL, but not DL, phenotypes. Nonetheless, the URE-IRE regions exhibit chromosome pairing effects whereby the homozygosis for PL87 restores normal expression of the gene [31]. Although the LacZ reported expression domains instructed by URE and IRE seem identical, they are not functionally redundant because the homozygosis for l(1)23437, which deletes the URE domain only, is still lethal [31]. Likewise, the homozygosis for any of the DL rearrangements maintains the dominant lethality. The clustering of DL rearrangements towards the 3’ end of wupA, plus the failure of incomplete genomic fragments to rescue DL phenotypes, suggests that the integrity of the transcription unit and, likely, some adjacent sequences upwards of its 5’ end, is required for the normal expression of the gene. This clustering of DL mutants would be akin to regulatory landscapes proposed for some developmental genes [56]. Consistent with this proposal, the available database information on Hi-C domains [57,58] indicate that the wupA gene is contained within a single tridimensional chromatin domain (http://epigenomegateway.wustl.edu/browser). Thus, the native chromatin in and around wupA could be required to support the hypothetical structural regulatory component of its HL function. The role of chromatin structure on the transcriptional regulation of adjacent genes, however, is still a matter of debate including the potential tissue dependent differences of Hi-C domains [59]. Quantitative regulation of gene transcripts can be achieved by a number of mechanisms, including their codon identity composition, which affects their stability [60], or through modified tRNAs, which affect their translational efficiency [61]. Also, genomes may differ in their DNA content, both between cells and between individuals, and this variation is thought to contribute to adaptation and evolution [62–65].
Although the actual mechanism for wupA regulation is still unknown, the existing data underscore the fact that that mechanism must ensure a proper quantitative control among TnI isoforms for normal biology. Is this quantitative regulation a peculiarity of HL genes?
Haplolethal versus Haploinsufficient genes
From yeast to flies, the haploid condition for genes encoding proteins with very general functions in cell biology results in haploinsufficiency. For instance, Minute genes in Drosophila are involved in translation or general metabolism, and their heterozygous M/+ condition causes developmental delay, reduced size and low viability [66]. However, out of the 66 Minutes identified so far [21], none of them can be linked to a HL gene. Actually, none of the known mutants in wupA or dpp show Minute-like phenotypes. Another example is provided by the RNA-polymerase II subunits encoding genes. Out of the 13 members of this family [67,68], none of them have been linked to HL regions. Equivalent to fly Minutes, the 170 haploinsufficient genes in yeast can be recovered as viable organisms if the culture medium is metabolically adjusted [5]. Thus, a basic biological role of the encoded products does not seem to justify a HL condition (see also Tabl4 in [21] for other haploinsufficient, non haplolethal, genes).
The location of wupA on the sexually dimorphic X chromosome invited to consider the possibility that its HL condition could result from a defective form of dosage compensation mechanisms akin to those already known to tune up the transcription of X-linked genes in males [69–72]. However, our previous experiments addressing the possibility of altered dosage compensation for wupA mutants yielded negative results [26]. Also, dpp and two other HL cases are located in autosomes. The relevant question, then, is what is so peculiar about HL genes?
Now that two HL genes, dpp and wupA, are known in some depth we can try to point out similarities among them. Two features are in common in both cases, the corresponding DL mutants are chromosomal rearrangements, and the affected gene encodes several transcripts. These two features can hardly be considered as distinguishing peculiarities with respect to other genes. It could be argued that one or several gene products are required in a critical amount for viability. The case of wupA HL shows (Table 2) that none of the transcriptional products, taken one at a time, rescue the DL mutants; thus, it is clear that the hypothetically critical amount for viability should correspond to more than one product. We co-overexpressed several of the UAS constructs (see foot note on Table 2) but none of them rescued the DL phenotype. Only when all white subset of wupA products are eliminated (mutants 18320C and 18320B), a DL phenotype is obtained. Thus, the DL mutant phenotype seems to result from the cumulative depletion of many TnI isoforms, which play diverse roles in muscle contraction, apico/basal cell polarity, cell proliferation, gene transcription, among others. It is worth pointing out that TnI is an Actin-binding type of protein and, consequently, its presence would be required in most force generating mechanisms in the cell. We envision that the functional diversity among the 11 wupA proteins represents a wide repertoire of mechanistic specificities, and the DL mutants are, in effect, a combined haploinsufficiency for the entire, or most of it, repertoire. As for dpp, although only one protein is known, DPP, its acting transcription factor is the Mothers-against-dpp (MAD) complex which includes the CDK8 and CycC components [73], a feature that seems akin to the role of TnI upon CDK2 and CDK4. In both cases, these signaling pathways control cell proliferation and several other cell signaling processes.
While the still scant information about HL genes of Drosophila is increased, it may be of interest to inquire about their homologues in vertebrates. The fly genes wupA and dpp have homologues in humans, TNNI and BMP, respectively. However, neither of them has maintained their HL condition in vertebrates. While wupA encodes 11 TnI isoforms, the TNNI human counterparts are encoded in three different genes, TNNI1, TNNI2 and TNNI3. Based on the association between copy number variation and certain types of cancer (Catalogue of Somatic Mutations in Cancer: https://cancer.sanger.ac.uk/cosmic), and experimental tumor cell growth suppression, TNNI1 seems the closest homologue to wupA [18]. The sequence similarity between the three human genes versus the single fly gen, however, is not very different (31, 32 and 34%, respectively). The corresponding chromosomal locations, 1q32.1, 11p15.5 and 19q13.42, respectively, are not included in the regions never recovered in haploid condition. Nevertheless, whole genome analysis of the predicted probability of being haploinsufficient, indicates that TNNI3 has a high probability [1]. A protein interactome data base (http://www.interactome-atlas.org/search) shows that the three human TNNI interact with several proteins beyond the classical components of the muscle sarcomere. Notably, TNNI1 exhibits the largest repertoire of interactions including, among others, RPAC1, a DNA-dependent RNA polymerase, and CDC7AL, a cell cycle associated protein. These features are consistent with the transcriptional and cell proliferation effects identified here for Drosophila TnI. As for DPP/BMP, although the fly gene encodes 1 protein through 5 transcripts, the human homologue is represented by a family of 10 members, from which BMP2 and BMP4 can be considered the closest to dpp. Concerning Vegf and Tcof1, the murine and human homologs have in common the coding for several proteins, and the presence of multiple (Vegf) or two (Tcof1) ATG sites (www.Ensembl.org).
One would have expected that HL functions will be under such a negative selective pressure as to have been eliminated. Yet, they seem to exist in far apart species; Drosophila contains five of them, and mice at least two. Actually, this paradox extends to haploinsufficient genes since they represent a barrier to organismal fitness due to the resulting pathologies. A dosage-stabilizing hypothesis has been proposed to explain the persistence of haploinsufficient genes, based on the possibility that, both in their attenuated and excess of function conditions are deleterious for the organism [64]. Although we do not argue against this proposal, we find it unlikely for haplolethality because large duplications covering each of these fly HL regions, except Tpl, are viable. We speculate that HL functions have been maintained in evolution because they exhibit two key features: 1) The multiplicative effect of dosage reduction of several functionally related products, and 2) The complex regulatory mechanism among these products which need to be expressed in specific quantities and combinations. Since all fly TnI isoforms are encoded in a single gene, its HL condition becomes unavoidable. Only when the repertoire of products splits into separate genes, as after gene duplication, the initial HL function could dissociate from the initial single gene. That dissociation, however, would be apparent only. Likely, the combined haploidy of the duplicated genes would reveal again the original haplolethality. Under this hypothesis, haplolethality would not be a property of the gene, but a property of the quantitative requirements of the ensemble of encoded products. A prediction of this hypothesis will be that the combined haploinsufficiency of the three TNNI genes of vertebrates should result in a DL phenotype. Also, it can be expected that functional interactions or interferences among vertebrate TNNI isoforms are likely to occur. A similar prediction could be made for the combined haploidy of most, if not all, BMP genes of vertebrates. A systematic search for HL functions in a particular genome could unveil regulatory interactions unsuspected hitherto. In all likelihood, the HL condition of wupA in Drosophila is not unique across genomes. However, to find out if other HL regions result from a quantitative regulation of combinations of gene products, equivalent studies to those carried out here will be necessary. The data reported here underscore the biological relevance of protein dosage of functionally related products.
Materials and methods
Mutant strains
Flies were raised in standard fly food at 25°C. As wupA mutations we used the following fly stocks from our own collection: Df(1) TnI23437, In(1)PL87 and In(1)PG31 [33] are three rearrangements located the 5`URE and IRE regulatory region of the gene [31] (see also Fig 2). Other mutant alleles and genomic constructs have been described previously [26,30]. To elicit excess of wupA function, we used the PBac(WH)f06492 construct from Exelixis referred here as UAS-TnIf06492. The genomic fragments CH322-143G12 (22251 bp), CH322-61E02r (20843 bp) or CH322-04P16r (18542 bp) were generated in [74]. The three fragments were cloned in the vector attB-P[acman]-CmR-BW-F-2-attB-BW3 (accession FJ931533). Each bacterial artificial chromosome (BAC) was injected in embryos of the stock y1 M{vas-int.Dm}ZH-2A w[*]; M{3xP3-RFP.attP’}ZH-22A (BL24481) and adult transgenic flies were selected by the reporter RFP signal in the oceli. To analyze other HL regions, the following stocks were obtained from the Bloomington collection: C(X;Y), y sn Grip91/C(1)RM, y v; Dp(1;f)LJ9, y+ (BL5128); Dp(2;1)G146,dpp+/FM7i; dppH46 wgSp cn bw/CyO (BL2060); Df(1)hl-a, w cv B/FM6; Dp(1;2)sn+72d/+ (BL6698) and Dp(1;2)CH322-143G12r/CyO; UAS(y+v+) upRNAiattP2/TM6 (from BL31541).
Generation of UAS-wupA transgenic lines
All DNA plasmids were generated by RECOMBINA S.L. (Navarra, Spain). Full length DNA sequence of each wupA transcript was amplified by PCR. The products were cloned in pENTRY vector as an intermediate step. Then, each wupA fragment was subcloned in pUASp vector via NotI/XbaI restriction enzymes and injected in y w embryos. For the HA-tagged version of the K isoform, the wupA-K coding sequence was amplified by PCR. The primers wupA-K-HA forward and wupA-K-HA reverse introduced an in-frame HA epitope coding sequence in 3´. The fragments were cloned in pENTRY vector and subcloned in pUASp vector via KpnI/XbaI restriction enzymes and injected in y w embryos. Sequence primers were as follows:
wupA-K-HA F>cggGGTACCatggaggaagcctccaaggccaa
wupA-K-HA R>tagTCTAGAttaAGCGTAATCTGGTACGTCGTATGGGTAagcttcggcctcaacctcct
Somatic clone induction and quantification
Crosses were set with 10 females and 10 males per vial at 25°C changed every 72 hours to avoid overcrowding. FLP-out clones were obtained by delivering a heat shock (8 minutes at 37°C) during 2nd instar larvae of HsFlp; Act-FRT-yellow-FRT-Gal4; + crossed against the corresponding UAS-wupA transgenic line isoform (A, -B, -C, -D, -E, -F, -G, -H, -I, -J or -K). 48 hours after heat shock, 3rd instar wandering larvae were dissected for clone screening. Control cultures (UAS-LacZ) were run in parallel. A software-assisted area measurement (Bitplane’s Imaris Surface) was used to obtain clone area and cell size. Cell profiles are identified by the myrRFP reporter and cell nuclei are revealed by DAPI. The “surface” option was chosen to measure the areas occupied by DAPI or RFP pixels from the entire 3D image. The area of the clone (RFP-marked) was calculated and divided by DAPI-marked area. As a result, the percentage of wing disc occupied by genetically marked cells was represented.
Viability quantification
To determine the rescue of dominant lethal phenotypes, we performed viability assays. 10 females and 10 males were crossed and maintained in the same tube for 72 hours, then adult flies were changed to a new tube and embryos were incubated at 25°C. The total number of adult flies was counted in three independent experiments. The number of experimental adult flies was divided by the number of control siblings (balancer) adult flies to indicate the survival ratio.
Quantitative PCR assays
For qRT-PCR assays, RNA was extracted with Trizol (Invitrogen) according to standard procedures. To prevent genomic DNA contamination all RNA samples were treated with DNaseI according to manufacturer´s procedures (30 min at 37°C). Primers were designed to anneal in different exons from each gene, later qPCR products were run in 2% agarose gels to analyze the bands. All the products correspond with their expected length, which indicates that no genomic DNA contamination was present. Assays were performed in triplicates using RNApolII as a housekeeping gene. Drosophila Troponin-I TaqMan Gene Expression probe (Applied Biosystems) was used. Used primers were:
wupA 5-6F GGCTAAACAGGCTGAGATCG
wupA 6a R TCGATGATGCGTCTACGTTC
wupA 6b R TCAACATCCTTGCGTTTAACA
wupA 6c R AAATCGTACTTTTCGGACTCCA
wupA 6d R AGATCCCATTTCTGGCCTTC
wupA 11/12 F GCCCAAGTTAACGATCTTCG
wupA 11/12 R TCCAGCGTGAACTCCTTCTT
RpL32 F TGTCCTTCCAGCTTCAAGAT
RpL32 R CTTGGGCTTGCGCCATTTG
Statistics
Statistical significance was calculated with the two-tailed Student’s t-test or ANOVA test. Significance levels are indicated as *p < 0,05; **p < 0,005 or ***p < 0,001. Number of samples N > 8 animals in confocal imaging, and n = 3 sets of 5 adults, male or female as indicated, for qPCR experiments.
Supporting information
S1 Fig [tif]
Physical map of with respect to and adjacent proximal genes.S2 Fig [1]
Functional analysis of .S3 Fig [tif]
Transcriptional effects of TnI isoform K overexpression upon selected genes.S4 Fig [tif]
Overexpression of TnI isoform K in wing domains cause morphological abnormalities.S5 Fig [tif]
Transcriptional effects of TnI isoform K overexpression upon other TnI isoforms.S6 Fig [tif]
Design of CRISPR/Cas9 mutations in the white ATG site of .S7 Fig [tif]
Schematic representation of allelic series.S8 Fig [tif]
Western blots of DL, SDL and RL mutants of .S1 Table [docx]
Genotypes tested in the functional analysis of Dp1 and Dp2 (see ) and in the HL regions interaction assay.
Zdroje
1. Huang N, Lee I, Marcotte EM, Hurles ME. Characterising and predicting haploinsufficiency in the human genome. PLoS Genet. 2010. doi: 10.1371/journal.pgen.1001154 20976243
2. Ikuno M, Yamakado H, Akiyama H, Parajuli LK, Taguchi K, Hara J, et al. GBA haploinsufficiency accelerates alpha-synuclein pathology with altered lipid metabolism in a prodromal model of Parkinson’s disease. Hum Mol Genet. 2019. doi: 10.1093/hmg/ddz030 30689867
3. Dutt S, Narla A, Lin K, Mullally A, Abayasekara N, Megerdichian C, et al. Haploinsufficiency for ribosomal protein genes causes selective activation of p53 in human erythroid progenitor cells. Blood. 2011. doi: 10.1182/blood-2010-07-295238 21068437
4. Cole CB, Russler-Germain DA, Ketkar S, Verdoni AM, Smith AM, Bangert C V., et al. Haploinsufficiency for DNA methyltransferase 3A predisposes hematopoietic cells to myeloid malignancies. Journal of Clinical Investigation. 2017. doi: 10.1172/JCI93041 28872462
5. Kaboli S, Miyamoto T, Sunada K, Sasano Y, Sugiyama M, Harashima S. Improved stress resistance and ethanol production by segmental haploidization of the diploid genome in Saccharomyces cerevisiae. J Biosci Bioeng. 2016. doi: 10.1016/j.jbiosc.2015.10.012 26690924
6. Deutschbauer AM, Jaramillo DF, Proctor M, Kumm J, Hillenmeyer ME, Davis RW, et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 2005. doi: 10.1534/genetics.104.036871 15716499
7. Giaever G, Nislow C. The yeast deletion collection: A decade of functional genomics. Genetics. 2014. doi: 10.1534/genetics.114.161620 24939991
8. Browning VL, Bergstrom RA, Daigle S, Schimenti JC. A halolethal locus uncovered by deletions in the mouse t complex. Genetics. 2002. 11861570
9. Winking H, Silver LM. Characterization of a recombinant mouse t haplotype that expresses a dominant lethal maternal effect. Genetics. 1984. 6510705
10. Howell GR, Munroe RJ, Schimenti JC. Transgenic rescue of the mouse t complex haplolethal locus Thl1. Mamm Genome. 2005;16 : 838–846. doi: 10.1007/s00335-005-0045-8 16284799
11. Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M, et al. Abnormal blood vessel development and lethality in embryos lacking a single vascular endothelial growth factor allele. Nature. 1996.
12. Dixon J. Increased levels of apoptosis in the prefusion neural folds underlie the craniofacial disorder, Treacher Collins syndrome. Hum Mol Genet. 2000. doi: 10.1093/hmg/9.10.1473 10888597
13. Martin CL, Kirkpatrick BE, Ledbetter DH. Copy Number Variants, Aneuploidies, and Human Disease. Clinics in Perinatology. 2015. doi: 10.1016/j.clp.2015.03.001 26042902
14. Johansson ACV, Feuk L. Characterization of copy number-stable regions in the human genome. Hum Mutat. 2011. doi: 10.1002/humu.21524 21542059
15. Lai HH, Chuang TH, Wong LK, Lee MJ, Hsieh CL, Wang HL, et al. Identification of mosaic and segmental aneuploidies by next-generation sequencing in preimplantation genetic screening can improve clinical outcomes compared to array-comparative genomic hybridization. Mol Cytogenet. 2017. doi: 10.1186/s13039-017-0315-7 28450889
16. Brewer C, Holloway S, Zawalnyski P, Schinzel A, Fitzpatrick D. A chromosomal deletion map of human malformations. Am J Hum Genet. 1998. doi: 10.1086/302041 9758599
17. Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, et al. Global variation in copy number in the human genome. Nature. 2006. doi: 10.1038/nature05329 17122850
18. Conrad DF, Andrews TD, Carter NP, Hurles ME, Pritchard JK. A high-resolution survey of deletion polymorphism in the human genome. Nat Genet. 2006. doi: 10.1038/ng1697 16327808
19. Babariya D, Fragouli E, Alfarawati S, Spath K, Wells D. The incidence and origin of segmental aneuploidy in human oocytes and preimplantation embryos. Hum Reprod. 2017. doi: 10.1093/humrep/dex324 29126206
20. Lindsley DL, Sandler L, Baker BS, Carpenter AT, Denell RE, Hall JC, et al. Segmental aneuploidy and the genetic gross structure of the Drosophila genome. Genetics. 1972. 4624779
21. Cook RK, Christensen SJ, Deal JA, Coburn RA, Deal ME, Gresens JM, et al. The generation of chromosomal deletions to provide extensive coverage and subdivision of the Drosophila melanogaster genome. Genome Biol. 2012. doi: 10.1186/gb-2012-13-3-r21 22445104
22. Hoffmann FM, Goodman W. Identification in transgenic animals of the Drosophila decapentaplegic sequences required for embryonic dorsal pattern formation. Genes Dev. 1987. doi: 10.1101/gad.1.6.615 2824286
23. Newfeld SJ, Takaesu NT. Local transposition of a hobo element within the decapentaplegic locus of Drosophila. Genetics. 1999. 9872958
24. Lee H, Cho DY, Whitworth C, Eisman R, Phelps M, Roote J, et al. Effects of Gene Dose, Chromatin, and Network Topology on Expression in Drosophila melanogaster. PLoS Genet. 2016. doi: 10.1371/journal.pgen.1006295 27599372
25. Malone JH, Cho DY, Mattiuzzo NR, Artieri CG, Jiang L, Dale RK, et al. Mediation of Drosophila autosomal dosage effects and compensation by network interactions. Genome Biol. 2012. doi: 10.1186/gb-2012-13-4-r28 22531030
26. Prado A, Canal I, Ferrús A. The haplolethal region at the 16F gene cluster of Drosophila melanogaster: Structure and function. Genetics. 1999. 9872957
27. Ferrus A, Llamazares S, De La Pompa JL, Tanouye MA, Pongs O. Genetic analysis of the Shaker gene complex of Drosophila melanogaster. Genetics. 1990. 2116353
28. Keppy DO, Denell RE. A mutational analysis of the triplo-lethal region of Drosophila melanogaster. Genetics. 1979. 110655
29. Barbas JA, Galceran J, Krah-Jentgens I, De La Pompa JL, Canal I, Pongs O, et al. Troponin I is encoded in the haplolethal region of the Shaker gene complex of Drosophila. Genes Dev. 1991. doi: 10.1101/gad.5.1.132 1899228
30. Barbas JA, Galceran J, Torroja L, Prado A, Ferrús A. Abnormal muscle development in the heldup3 mutant of Drosophila melanogaster is caused by a splicing defect affecting selected troponin I isoforms. Mol Cell Biol. 1993. doi: 10.1128/mcb.13.3.1433 7680094
31. Marín MC, Rodríguez JR, Ferrús A. Transcription of Drosophila Troponin I Gene is Regulated by Two Conserved, Functionally Identical, Synergistic Elements. Mol Biol Cell. 2004;15 : 1185–1196. doi: 10.1091/mbc.e03-09-0663 14718563
32. Sahota VK, Grau BF, Mansilla A, Ferrús A. Troponin I and Tropomyosin regulate chromosomal stability and cell polarity. J Cell Sci. 2009;122 : 2623–2631. doi: 10.1242/jcs.050880 19567471
33. Casas-Tintó S, Maraver A, Serrano M, Ferrús A. Troponin-I enhances and is required for oncogenic overgrowth. Oncotarget. 2016. doi: 10.18632/oncotarget.10616 27437768
34. Prado A, Canal I, Barbas JA, Molloy J, Ferrús A. Functional recovery of troponin I in a Drosophila heldup mutant after a second site mutation. Mol Biol Cell. 1995. doi: 10.1091/mbc.6.11.1433 8589447
35. Sarov M, Barz C, Jambor H, Hein MY, Schmied C, Suchold D, et al. A genome-wide resource for the analysis of protein localisation in Drosophila. Elife. 2016. doi: 10.7554/eLife.12068 26896675
36. Gil N, Ulitsky I. Regulation of gene expression by cis-acting long non-coding RNAs. Nature Reviews Genetics. 2020. doi: 10.1038/s41576-019-0184-5 31729473
37. Lefrevre G, Johnson TK. Evidence for a sex linked haplo inviable locus in the cut singed region of Drosophila melanogaster. Genetics. 1973.
38. Homyk T, Emerson CP. Functional interactions between unlinked muscle genes within haploinsufficient regions of the Drosophila genome. Genetics. 1988. 3135237
39. Casas-Tintó S, Ferrús A. Troponin-I mediates the localization of selected apico-basal cell polarity signaling proteins. J Cell Sci. 2019;132. doi: 10.1242/jcs.225243 30872455
40. Read RD, Cavenee WK, Furnari FB, Thomas JB. A Drosophila model for EGFR-Ras and PI3K-dependent human glioma. PLoS Genet. 2009. doi: 10.1371/journal.pgen.1000374 19214224
41. Alevizopoulos K, Vlach J, Hennecke S, Amati B. Cyclin E and c-Myc promote cell proliferation in the presence of p16(INK4a) of hypophosphorylated retinoblastoma family proteins. EMBO J. 1997. doi: 10.1093/emboj/16.17.5322 9311992
42. Elend M, Eilers M. Cell growth: Downstream of Myc—To grow or to cycle? Current Biology. 1999. doi: 10.1016/s0960-9822(00)80109-8 10607581
43. Datar SA, Jacobs HW, De La Cruz AFA, Lehner CF, Edgar BA. The Drosophila Cyclin D-Cdk4 complex promotes cellular growth. EMBO J. 2000. doi: 10.1093/emboj/19.17.4543 10970848
44. Frei C. Cyclin D/Cdk4: New insights from Drosophila. Cell Cycle. 2004. doi: 10.4161/cc.3.5.867 15044855
45. Pimentel AC, Venkatesh TR. rap gene encodes Fizzy-related protein (Fzr) and regulates cell proliferation and pattern formation in the developing Drosophila eye-antennal disc. Dev Biol. 2005. doi: 10.1016/j.ydbio.2005.07.011 16098963
46. Chen PI, Kong C, Su X, Stahl PD. Rab5 isoforms differentially regulate the trafficking and degradation of epidermal growth factor receptors. J Biol Chem. 2009. doi: 10.1074/jbc.M109.034546 19723633
47. Wharton KA, Ray RP, Gelbart WM. An activity gradient of decapentaplegic is necessary for the specification of dorsal pattern elements in the Drosophila embryo. Development. 1993. 8330541
48. Farah CS, Reinach FC. The troponin complex and regulation of muscle contraction. FASEB J. 1995. doi: 10.1096/fasebj.9.9.7601340 7601340
49. Caridi CP, Plessner M, Grosse R, Chiolo I. Nuclear actin filaments in DNA repair dynamics. Nature Cell Biology. 2019. doi: 10.1038/s41556-019-0379-1 31481797
50. Capelson M. How Genes Move: Spatial Repositioning of Activated Genes Is Driven by Nuclear Actin-Based Pathway. Dev Cell. 2020. doi: 10.1016/j.devcel.2020.01.019 32049034
51. Wang A, Kolhe JA, Gioacchini N, Baade I, Brieher WM, Peterson CL, et al. Mechanism of Long-Range Chromosome Motion Triggered by Gene Activation. Dev Cell. 2020;52 : 309-320.e5. doi: 10.1016/j.devcel.2019.12.007 31902656
52. Foster DB, Noguchi T, VanBuren P, Murphy AM, Van Eyk JE. C-Terminal Truncation of Cardiac Troponin I Causes Divergent Effects on ATPase and Force: Implications for the Pathophysiology of Myocardial Stunning. Circ Res. 2003. doi: 10.1161/01.RES.0000099889.35340.6F 14551240
53. Vylegzhanina A V., Kogan AE, Katrukha IA, Koshkina E V., Bereznikova A V., Filatov VL, et al. Full-size and partially truncated cardiac troponin complexes in the blood of patients with acute myocardial infarction. Clin Chem. 2019. doi: 10.1373/clinchem.2018.301127 30858159
54. Kedar V, McDonough H, Arya R, Li HH, Rockman HA, Patterson C. Muscle-specific RING finger 1 is a bona fide ubiquitin ligase that degrades cardiac troponin I. Proc Natl Acad Sci U S A. 2004. doi: 10.1073/pnas.0404341102 15601779
55. Bin Yu Z, Zhang LF, Jin JP. A Proteolytic NH2-terminal Truncation of Cardiac Troponin I that is Up-regulated in Simulated Microgravity. J Biol Chem. 2001. doi: 10.1074/jbc.M011048200 11278823
56. Bolt CC, Duboule D. The regulatory landscapes of developmental genes. Dev. 2020. doi: 10.1242/dev.171736 32014867
57. Sexton T, Yaffe E, Kenigsberg E, Bantignies F, Leblanc B, Hoichman M, et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 2012. doi: 10.1016/j.cell.2012.01.010 22265598
58. Lieberman-Aiden E, Van Berkum NL, Williams L, Imakaev M, Ragoczy T, Telling A, et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science (80-). 2009. doi: 10.1126/science.1181369 19815776
59. Ghavi-Helm Y, Jankowski A, Meiers S, Viales RR, Korbel JO, Furlong EEM. Highly rearranged chromosomes reveal uncoupling between genome topology and gene expression. Nat Genet. 2019. doi: 10.1038/s41588-019-0462-3 31308546
60. Bazzini AA, Viso F, Moreno-Mateos MA, Johnstone TG, Vejnar CE, Qin Y, et al. Codon identity regulates mRNA stability and translation efficiency during the maternal-to-zygotic transition. EMBO J. 2016. doi: 10.15252/embj.201694699 27436874
61. Lorent J, Kusnadi EP, Hoef V, Rebello RJ, Leibovitch M, Ristau J, et al. Translational offsetting as a mode of estrogen receptor α-dependent regulation of gene expression. EMBO J. 2019. doi: 10.15252/embj.2018101323 31556460
62. Zarrei M, MacDonald JR, Merico D, Scherer SW. A copy number variation map of the human genome. Nature Reviews Genetics. 2015. doi: 10.1038/nrg3871 25645873
63. Hastings PJ, Lupski JR, Rosenberg SM, Ira G. Mechanisms of change in gene copy number. Nature Reviews Genetics. 2009. doi: 10.1038/nrg2593 19597530
64. Ng PC, Levy S, Huang J, Stockwell TB, Walenz BP, Li K, et al. Genetic variation in an individual human exome. PLoS Genet. 2008. doi: 10.1371/journal.pgen.1000160 18704161
65. Ibn-Salem J, Köhler S, Love MI, Chung HR, Huang N, Hurles ME, et al. Deletions of chromosomal regulatory boundaries are associated with congenital disease. Genome Biol. 2014. doi: 10.1186/s13059-014-0423-1 25315429
66. Ferrus A. Parameters of mitotic recombination in minute mutants of Drosophila melanogaster. Genetics. 1975;79 : 589–599. 805750
67. Jishage M, Yu X, Shi Y, Ganesan SJ, Chen WY, Sali A, et al. Architecture of Pol II(G) and molecular mechanism of transcription regulation by Gdown1. Nat Struct Mol Biol. 2018. doi: 10.1038/s41594-018-0118-5 30190596
68. Aoyagi N, Wassarman DA. Genes encoding Drosophila melanogaster RNA polymerase II general transcription factors: Diversity in TFIIA and TFIID components contributes to gene-specific transcriptional regulation. J Cell Biol. 2000. doi: 10.1083/jcb.150.2.f45 10908585
69. Salz HK, Erickson JW. Sex determination in Drosophila: The view from the top. Fly (Austin). 2010. doi: 10.4161/fly.4.1.11277 20160499
70. Meisel RP, Malone JH, Clark AG. Faster-X Evolution of Gene Expression in Drosophila. PLoS Genet. 2012. doi: 10.1371/journal.pgen.1003013 23071459
71. Conrad T, Akhtar A. Dosage compensation in Drosophila melanogaster: Epigenetic fine-tuning of chromosome-wide transcription. Nature Reviews Genetics. 2012. doi: 10.1038/nrg3124 22251873
72. Villa R, Schauer T, Smialowski P, Straub T, Becker PB. PionX sites mark the X chromosome for dosage compensation. Nature. 2016. doi: 10.1038/nature19338 27580037
73. Li X, Liu M, Ren X, Loncle N, Wang Q, Hemba-Waduge RUS, et al. The Mediator CDK8-Cyclin C complex modulates Dpp signaling in Drosophila by stimulating Mad-dependent transcription. PLoS Genet. 2020. doi: 10.1371/journal.pgen.1008832 32463833
74. Venken KJT, Carlson JW, Schulze KL, Pan H, He Y, Spokony R, et al. Versatile P[acman] BAC libraries for transgenesis studies in Drosophila melanogaster. Nat Methods. 2009. doi: 10.1038/nmeth.1331 19465919
75. Ejsmont RK, Sarov M, Winkler S, Lipinski KA, Tomancak P. A toolkit for high-throughput, cross-species gene engineering in Drosophila. Nat Methods. 2009. doi: 10.1038/nmeth.1334 19465918
Článek Gene disruption by structural mutations drives selection in US rice breeding over the last centuryČlánek Doublesex regulates fruitless expression to promote sexual dimorphism of the gonad stem cell nicheČlánek Synaptonemal Complex dimerization regulates chromosome alignment and crossover patterning in meiosis
Článek vyšel v časopisePLOS Genetics
Nejčtenější tento týden
2021 Číslo 3- Psilocybin je v Česku od 1. ledna 2026 schválený. Co to znamená v praxi?
- AUDIO: (Jak) je možné prodloužit si život?
- Alergie na antibiotika u žen s infekcemi močových cest − poznatky z průřezové studie z USA
- Koordinátoři onkologické péče zkrátí pacientům cestu systémem. Jak to bude fungovat v praxi?
- 4× stručně ke zpřesnění diagnostiky civilizačních chorob – „jednohubky“ z klinického výzkumu 2026/5
-
Všechny články tohoto čísla
- Natural variation in the regulation of neurodevelopmental genes modifies flight performance in Drosophila
- The haplolethality paradox of the wupA gene in Drosophila
- Independent domains for recruitment of PRC1 and PRC2 by human XIST
- Synaptonemal Complex dimerization regulates chromosome alignment and crossover patterning in meiosis
- DNA polymerase theta suppresses mitotic crossing over
- Double drives and private alleles for localised population genetic control
- Integrative genomic analysis of early neurogenesis reveals a temporal genetic program for differentiation and specification of preplate and Cajal-Retzius neurons
- Gene disruption by structural mutations drives selection in US rice breeding over the last century
- NCK-associated protein 1 like (nckap1l) minor splice variant regulates intrahepatic biliary network morphogenesis
- Reduction of WDR81 impairs autophagic clearance of aggregated proteins and cell viability in neurodegenerative phenotypes
- A loss-of-function mutation in RORB disrupts saltatorial locomotion in rabbits
- Genome-wide association study of fish oil supplementation on lipid traits in 81,246 individuals reveals new gene-diet interaction loci
- A cohesin cancer mutation reveals a role for the hinge domain in genome organization and gene expression
- The microcephaly gene Donson is essential for progenitors of cortical glutamatergic and GABAergic neurons
- Behavior of dicentric chromosomes in budding yeast
- Assessing the co-variability of DNA methylation across peripheral cells and tissues: Implications for the interpretation of findings in epigenetic epidemiology
- Characterization of C9orf72 haplotypes to evaluate the effects of normal and pathological variations on its expression and splicing
- Neuropeptide F signaling regulates parasitoid-specific germline development and egg-laying in Drosophila
- Identification of MFRP and the secreted serine proteases PRSS56 and ADAMTS19 as part of a molecular network involved in ocular growth regulation
- The long noncoding RNA FRILAIR regulates strawberry fruit ripening by functioning as a noncanonical target mimic
- The etiology of Down syndrome: Maternal MCM9 polymorphisms increase risk of reduced recombination and nondisjunction of chromosome 21 during meiosis I within oocyte
- Analysis of the SNARE Stx8 recycling reveals that the retromer-sorting motif has undergone evolutionary divergence
- activin-2 is required for regeneration of polarity on the planarian anterior-posterior axis
- The capacity of origins to load MCM establishes replication timing patterns
- Doublesex regulates fruitless expression to promote sexual dimorphism of the gonad stem cell niche
- Expression of Concern: 24-Hour Rhythms of DNA Methylation and Their Relation with Rhythms of RNA Expression in the Human Dorsolateral Prefrontal Cortex
- Drivers of linkage disequilibrium across a species’ geographic range
- IKAROS is required for the measured response of NOTCH target genes upon external NOTCH signaling
- Androgens regulate ovarian gene expression by balancing Ezh2-Jmjd3 mediated H3K27me3 dynamics
- AMPK-dependent and -independent coordination of mitochondrial function and muscle fiber type by FNIP1
- Distant activation of Notch signaling induces stem cell niche assembly
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- DNA polymerase theta suppresses mitotic crossing over
- NCK-associated protein 1 like (nckap1l) minor splice variant regulates intrahepatic biliary network morphogenesis
- Synaptonemal Complex dimerization regulates chromosome alignment and crossover patterning in meiosis
- A loss-of-function mutation in RORB disrupts saltatorial locomotion in rabbits
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání